1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
baherus [9]
3 years ago
12

The female sex organ of the ferns that produce an egg cell is called?​

Biology
1 answer:
Afina-wow [57]3 years ago
6 0
It’s called the Ovaries
You might be interested in
Smallpox is a virus that causes a rash that then turns into painful blisters. The last known case of smallpox was in 1977. What
Butoxors [25]
What's the question???
5 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Researchers studying parental care in 20 female robins found that every female robin would place a recently collected worm into
IrinaVladis [17]

The correct answer is; the open mouth of a baby robin is seen as a sign stimulus for the female robin (parent), and that the open mouth is the impending cause for her behavior.

7 0
3 years ago
Read 2 more answers
Cell division in an animal cell. (False-color LM: 9000x)​
natali 33 [55]

Answer:

true

Explanation:

The centrosome is a cellular organelle which is the main microtubule organizing centre in an animal cell which also regulates the process of cell-cycle.

They are made up of two centrioles which are right angled to each other and is composed of a protein known as tubulin.

So the statement is true.

plz mate mark me as brainliest

6 0
3 years ago
Which of the following statements is not part of the cell theory?
Karo-lina-s [1.5K]
The statement that is not part of the cell theory is C) only animals are composed of cells.
On the other hand, A) cells are the basic unit of structure and function in living things, B) all cells are produced from other cells, and D) all living things are composed of cells are correct.
8 0
3 years ago
Other questions:
  • Which choice best describes the purpose of most pharmacogenomic research??
    10·1 answer
  • List five introduced species that present a serious threat to their new communities. explain the damage done by each introduced
    7·2 answers
  • Which of the following statements about homologous chromosomes is correct?
    10·1 answer
  • In the phosphorus cycle, phosphorus can recycle through waste products, decomposition, and of terrestrial and aquatic ecosystems
    6·2 answers
  • Please list and discuss the indications and steps used during endotracheal suctioning. Suggested Fundamentals Learning Activity:
    15·1 answer
  • Which of the following organic molecules is a major storage carbohydrates used to store energy in plants ?
    5·2 answers
  • Help idk what this is
    8·1 answer
  • Part b: which phrase from the text best supports the answer to part a?
    6·1 answer
  • Explain the importance of the surface area to volume of ratio
    14·1 answer
  • Wild turkeys have been found to court in pairs, the pairs are usually brothers. What is the significance of this discovery.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!