1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marysya [2.9K]
3 years ago
7

Do you know the different stages through which raw agricultural materials go before they reach your table? Trace the journey of

a burger bun from grains of wheat at a farm to your table. Perform online or offline research and write a report on the processes involved in manufacturing burger buns.
Biology
2 answers:
Anni [7]3 years ago
6 0

Answer:

The elevator can store the grain until the right market price, or it can sell it. Country elevators sell their grain to terminal elevators, which clean, separate and maintain the value of the grain. The grain is then sold to flour millers for domestic consumption, or it is loaded into ships bound for overseas markets.

GaryK [48]3 years ago
6 0

PLATO ANSWER

The basic raw material for making a burger bun is flour. The major steps required for turning wheat into a burger bun are as follows:

Cultivation of wheat

Harvesting of wheat

Grinding wheat to flour

Baking flour to make buns

Let’s trace the journey.

Before a burger bun reaches the table, it goes through several processes. The farmer select wheat heads when they turn golden yellow and the kernels are hard and dry. A combine harvests the wheat and packs it in sacks. The farmer then stores the wheat in a granary and eventually sells it to a wholesale trading company. The wholesaler transports the wheat to a warehouse and then sells it to a flour manufacturer. The manufacturer`s first step is to cleanse the wheat of impurities, such as weeds, seeds, dirt, small stones, and metal pieces, by using a series of giant disks and magnets. The kernels then go through a giant bath, which separates any other heavy particles that remain. It also helps cleanse the grains. Lighter materials such as husks or flakes of stalk will wash away.

After the cleaning process, the wheat goes through rollers that crack the kernel, and then huge machines use various screens to filter the wheat pieces. In the production of white flour, air currents blow the bran away from the rest of the wheat, and then the remaining pieces of wheat go through a variety of rollers that grind it into finer powder. After each grinding, the machines sift the wheat through screens—and there are more than 20 such screens. Each screen filters finer and finer particles. Finally, the manufacturer fortifies the wheat by adding special ingredients such as vitamins and iron. The manufacturer then packs, labels, and stores the ready-to-bake flour for transportation and supply.

The packaged wheat flour reaches the store racks through a variety of distributors and suppliers and by various means of transport. Once on the shelf, it is a matter of time before a consumer purchases it. Some of the packaged products may reach industrial baking organizations.

After bringing home some flour, I unpack it and then mix it with salt, water, yeast, and a few other ingredients. Before rolling it, I have to give the dough some time to rise. The yeast in the dough makes it rise through the action of tiny bubbles of carbon dioxide. I then form the dough into the correct shapes and put in the oven to bake. In the baking process, the gas bubbles exit the dough, leaving the bread soft and fluffy. After baking and cooling, the buns are ready to become parts of mouth-watering burgers.

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
How does a tornado form
Lesechka [4]
A tornado is formed by two rocks hitting together under the ground which makes the ground shake.
3 0
4 years ago
Read 2 more answers
EMERGENCY PLS HELP: explain how the kindergarten in the video was designed differently from other kindergartens and/or at school
Ganezh [65]

Answer:

Live as if you were to die tomorrow. ...

“That which does not kill us makes us stronger.” ...

“Be who you are and say what you feel, because those who mind don't matter and those who matter don't mind.” ...

“We must not allow other people's limited perceptions to define us.”

7 0
2 years ago
In California, a species of salamanders were geographically separated over time. The group that lived in southern California rel
alex41 [277]

Answer:

It ocurred a selection by allopatric speciation

Explanation:

The allopatric speciation refers to the evolution in which the same specie starts developing different characteristics because of geographic barrers and this characteristics after some time generates two different specie.

It happens because usually according to the environment or the predators, species have to develop different adaptations so they can survive. In this case we have two different types of camouflage adaptations made by the salamanders acording to the conditions so for one specie it is better to camouflage from the predator mean while to the other is better to use lived colors to seem as it is a poisonous animal and in this way avoid the predators.

So you can see the same specie develop different strategies to survive because of a geographic separation, generating an allopatric speciation.

8 0
3 years ago
(01.02 MC) Which of the following questions would best help you evaluate claims about the healing properties of an expensive her
slega [8]
The correct option is this: HAS THE CLAIM BEEN TESTED NUMEROUS TIMES BY MORE THAN ONE SCIENTISTS.
For a claim to be accepted has been valid in the science world, it must have been tested several times by many scientists who obtain the same results. Having a uniform result about a phenomenon is usually considered an important factor when examining the validity of a claim. 
6 0
4 years ago
Other questions:
  • A species can develop genetic diversity.
    13·2 answers
  • When either trait in a dihybrid cross is homozygous recessive, what is that gene?
    11·1 answer
  • Which of these is not a function of your skin?
    8·2 answers
  • 4) Compare and contrast passive transport (including osmosis and facilitated transport) with active transport such as endocytosi
    15·1 answer
  • Question 7 (1 point)
    7·1 answer
  • Which of the following structures have a role in plant reproduction?
    12·2 answers
  • Which ball-and-socket joint is the most freely moveable joint in the body?
    12·2 answers
  • Which of these describe biodiversity?
    12·1 answer
  • What is water resource​
    14·2 answers
  • Where is most of the water that passes through the digestive tract reabsorbed?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!