1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
siniylev [52]
3 years ago
8

Is there a way to investigate whether our predictions about genotypes are accurate?

Biology
1 answer:
Bas_tet [7]3 years ago
6 0

Answer:

Test Crosses. A test cross is utilized to decide the genotype of a person with a attribute.

Explanation:

Brainliest?

You might be interested in
Roots grow into cracks and rocks and break them apart. This is an example of what type of weathering?
sukhopar [10]

Answer:

Wedging (for the first one)

Explanation:

7 0
4 years ago
Three students are arguing about the reason that an apple appears red. Student A claims that it is because an apple absorbs the
marin [14]

Answer:

Objects appear different colours because they absorb some colours (wavelengths) and reflected or transmit other colours. ... For example, a red shirt looks red because the dye molecules in the fabric have absorbed the wavelengths of light from the violet/blue end of the spectrum.

Explanation:

7 0
3 years ago
Read 2 more answers
Know what makes a solution acidic or basic (the pH number and the ions).
Brrunno [24]

To determine whether an acidic or basic solution, it is first necessary to compare the concentrations of the hydronium (H3O +) and hydroxide (OH-) ions in the solution.

In acidic solution, the concentration of H3O + ions is higher than that of OH- ions.

  • In acidic solution, the concentration of H3O + ions is higher than that of OH- ions. Such a solution can be achieved by adding a small part of the H3O + ions, for example. Acid solutions have a pH below 7, the further away from 7 the pH of the solution is the higher its acidity content.  According to Le Chatelier's principle, when a disturbance is caused to an equilibrium system, it tends to readjust in order to diminish the effects of that force. This means that if an acid is added to water, the H3O + ions will be in excess and the equilibrium will shift in the opposite direction to the left. Then these excess ions will react with the OH- ions. Thus, the concentration of OH- ions will decrease and the solution will become acidic.
  • In basic solutions, the concentration of OH- ions is higher than that of H3O + ions.  If we add a base to the water, it means that we will be adding OH- ions and, as explained in the previous section, by Le Chatelier's principle, the equilibrium of the water selfionization reaction will shift in the opposite direction, and the excess ions will react. with the H3O + ions, decreasing their concentration and making the basic solution.  Basic solutions have a pH greater than 7, the farther from 7 and closer to 14 the pH of the solution, the higher the basification content.

8 0
3 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Which of the following is not a technology that can be used to conserve resources? a. hydropower b. volcanic power c. natural ga
stich3 [128]

<u>Answer</u>: c. Natural gas.

<u>Explanation</u>:

  • <em>Natural gas</em> is a fossil fuel and thus a<em> non-renewable resource.</em>
  • Natural gas is widely used for the purpose of heating, cooking, and generation of electricity.
  • The process of formation of natural gas takes place over millions of years from decomposing plant and animal material subjected to heat and pressure.

<em>Thus, natural gas cannot be used for the conservation of resources.</em>


7 0
3 years ago
Read 2 more answers
Other questions:
  • The carbon in coal, oil, and natural gas came from?
    11·1 answer
  • (Select all that apply.) Choose from the following list the three groups of lipids.
    6·2 answers
  • What kinds of cells contains cytoskeleton ?
    8·1 answer
  • Two true breeding pea plants with green seeds will produce what color seeds
    15·1 answer
  • Which of the following is an example of a primary air pollutant?
    5·1 answer
  • Steering to the right will result in weight transfer to
    7·1 answer
  • Recovering the Romanovs &lt;- your second lab link On the lab page, please navigate using the top and bottom modules. For exampl
    11·1 answer
  • Which best describes paleomagnetism
    6·1 answer
  • Drag each term or definition to the right spot.
    13·1 answer
  • Please only respond if you know the answer. Also, links will be reported
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!