1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natta225 [31]
3 years ago
11

List 7 ways to conserve vegetation​

Biology
1 answer:
anyanavicka [17]3 years ago
7 0
<h2>Answer:</h2>

1.we should not cut trees as this can effect the food chain of animals.

2.we should water the plants everyday

3.we should atleast plant a baby plant every day.

4.we should not kill any animal.

5.we should decrease the use of plastics.

6.we should keep our area pollution free.

7.we should use natural pesticide to a plant

You might be interested in
Question: Which type of water holds the most drops on the surface of a penny before breaking the
Bingel [31]

Answer:

Plain Tap Water

Explanation:

You should find that plain tap water produces a much larger, stable drop of water on top of the penny than the soapy water does. This is because plain tap water has higher surface tension, so the surface is "stronger" and can hold together a larger drop.

6 0
3 years ago
If exhibited by an expectant father, what is a warning sign of ineffective adaptation to his partner's first pregnancy?
Sergio [31]

Answer:

Consistently changes the subject when the topic of the fetus/newborn is raised.

Explanation:

This is the decision of the couple whether they want a child or not and can discuss about the family planning as well. Different psychological aspects acn explain this matter.

The expectant father is not mentally prepared for the child. He might refuse the talks and stay away from the communication that are related to the new born child. This must be properly assessed and important to understand the feeling of the expectant father.  

Thus, the answer is consistently changes the subject when the topic of the fetus/newborn is raised.

4 0
3 years ago
a race car driver drives one lap around a track that is 500 meters in length. what is the drivers displacement at the end of the
sleet_krkn [62]

Answer:

0 meters

Explanation:

When we talk about displacement, think that the think of it as the measure of the distance between the starting point of the object, from its end point.

Since we are talking about a lap around a track, it would mean that the starting point is also the end point. So if you started and end at the same point, the distance between it would be 0.

5 0
3 years ago
What statement correctly describes a phospholipid in the plasma membrane
Flauer [41]
The head loves Water, Tail hates it
7 0
4 years ago
write the order that blood moves through the heart beginning with the return of blood to the heart from the upper and lower port
statuscvo [17]

Answer: circulatory system

Explanation:

Blood that return from the upper and lower parts of the body are deoxygenated hence they are transported to the heart for oxygenation. therefore blood enter the heart through vena cava ( the main vein) to the right auricles and it goes to the lower part of the heart which is the right ventricles which is more muscular. due to this blood is pumped from the right ventricles through pulmonary vein which pumps blood to the left ventricles through pulmonary artery and it is allowed to the left ventricles in the lower part of the heart and it pumped back in the body through the aorta( the main artery) .

8 0
3 years ago
Other questions:
  • A student observes an animal that has a backbone, gills, and scales. It lays eggs and is cold−blooded.
    15·1 answer
  • - regardless of how many colors you observed, explain why some pigments (in plants with more than one) move further than others.
    15·1 answer
  • Cognition is best described as: a) a reversible and normal suspension of consciousness. b) recognizing, processing, planning, an
    15·1 answer
  • The ""preservationist ethic"" is associated with ______________ .
    7·1 answer
  • 53 The plants in an ecosystem produce food
    7·1 answer
  • The oxygen is then combined with complex carbon-containing molecules in the ____ in a chemical reaction.
    13·1 answer
  • What are some nonlethal solutions to the problem of wolves attacking cattle and sheep?
    13·2 answers
  • What notation would you use to characterize Patient B's
    14·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Why are there so many ways to impact enzyme activity.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!