As discussed in Unit 10 of The Physics Classroom Tutorial, electromagnetic waves are waves that are capable of traveling through a vacuum. Unlike mechanical waves that require a medium in order to transport their energy, electromagnetic waves are capable of transporting energy through the vacuum of outer space. Electromagnetic waves are produced by a vibrating electric charge and as such, they consist of both an electric and a magnetic component. The precise nature of such electromagnetic waves is not discussed in The Physics Classroom Tutorial. Nonetheless, there are a variety of statements that can be made about such waves.
<span>Species because it narrows it down to one thing.</span>
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
Answer is A. Cdk7 of the CAK (TFIIH component) phosphorylates Cyclin 8 of the Mediator to down regulate promoter activity.
Refer below.
Explanation:
Cdk7 of the CAK (TFIIH component) phosphorylates Cyclin 8 of the Mediator to down regulate promoter activity is a FALSE STATEMENT.