1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Varvara68 [4.7K]
3 years ago
5

What's the meaning of DNA​

Biology
1 answer:
Zigmanuir [339]3 years ago
6 0

Answer:

DNA(deoxyribonucleic acid), is the hereditary material in humans and almost all other organisms.

You might be interested in
What keeps a white dwarf from collapsing under its own gravity
Rashid [163]
The electron degeneracy pressure keeps white dwarf stars from collapsing in on themselves.
5 0
3 years ago
Read 2 more answers
A child receives an X chromosome from its mother and a Y chromosome
maks197457 [2]

Answer:

the child must be male

Explanation:

8 0
3 years ago
La Rafflesia arnoldii es una planta tropical con una enorme flor rojo-sangre, que emite calor y despide olor a carne descompuest
Bingel [31]

Answer:

Rafflesia arnoldii is a tropical plant with a huge blood-red flower, which emits heat and emits the smell of decomposed meat. What use are these adaptations to this plant

Explanation:

The smell is adaptation for pollination.This is because it attracts insects which carry on the process of pollination.

Its possible Endothermy characteristic  is for mimicry Its releases  heat to attract  the pollinators- blowflies.The endothermic mechanism  is well pronounced during flora development: which further buttress the fact that this  is related to pollination to attract blowflies, and not to thermoregulation.

8 0
3 years ago
On which feature is pseudoscience based?
Ivanshal [37]
In general, pseudoscience is based on "<span>static information that does not change" because this kind of fake science doesn't change when new evidence is brought into light. </span>
4 0
3 years ago
Read 2 more answers
What is the line of defence involved in phagocytosis​
makkiz [27]

Answer:

The second line of defence is nonspecific resistance, which kills intruders in a broad manner without focusing on specific individuals: phagocytic cells ingest and kill any germs that enter body tissues.

Explanation:

3 0
3 years ago
Other questions:
  • During cellular respiration, cells convert oxygen and glucose into carbon dioxide, water, and energy. how is this process relate
    10·2 answers
  • If an object is moving with a force of 99N at 12.5m/sec2, what is the mass of this object?
    7·1 answer
  • If your lac operon looked like the image below, which of the following can you infer?
    6·1 answer
  • What is the vocabulary word for a section of dna that codes for a specific protein?
    11·1 answer
  • 2. Which organelle is responsible for making ribosomes?
    6·2 answers
  • All your cells have the same genes. True or false?
    14·1 answer
  • What is the main function of the human reproductive system?
    10·2 answers
  • What is facilitated diffusion??
    15·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • In an effort to control vegetation overgrowth, 108 rabbits are released in an isolated area free of predators. After 2 years, it
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!