1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bezzdna [24]
3 years ago
11

BEST GETS BRAINLYEST

Biology
2 answers:
gavmur [86]3 years ago
5 0

Answer:

carbon dioxide, water, and sunlight

Explanation:

glucose is what is created to feed the plant because of the three answers :)

hope this helped

marshall27 [118]3 years ago
3 0

Answer:

1. carbon dioxide, water, sunlight.

2. animals do not have chloroplasts.

3. oxygen, energy.

4. it did not receive sunlight.

5. the creation of oxygen.

Explanation:

I took the test and got 100 so it is write

You might be interested in
When the mitochondria lack adequate oxygen during activity, what product is formed from pyruvate?
erastovalidia [21]
Pyruvate undergoes fermentation if no oxygen is present. This is called anaerobic reaction. Can undergo lactic acid or alcoholic fermentation.
4 0
3 years ago
Find the meaning of ductile​
guapka [62]

Answer:

(of a metal) able to be drawn out into a thin wire.

able to be deformed without losing toughness; pliable, not brittle.

Note:

Please mark as Brainliest! <3

4 0
4 years ago
Read 2 more answers
During the germinal period of prenatal development, some cells become part of the brain, some become part of the leg, some becom
Alex73 [517]

Answer:

Cellular Differentiation

Explanation:

During the germinal period of prenatal development, some cells become part of the brain, some become part of the leg, some become part of the stomach, and so on. The term for this process is Cellular Differentiation

8 0
3 years ago
Which of the following describes soil and temperature in an ecosystem? *
NemiM [27]

Answer:

abiotic factors.

Explanation:

they are not living things

4 0
3 years ago
Read 2 more answers
Clear-cutting usually leads to fewer changes in the forest ecosystem than selective cutting. True or False
aleksley [76]
It would be considered false
6 0
3 years ago
Other questions:
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • Why are temperatures more moderate around the fall and spring equinoxes?
    5·2 answers
  • Which of the following is NOT a benefit of shared sleeping?
    14·1 answer
  • The conclusion in a science text
    9·1 answer
  • Enhancer I can stimulate the transcription of gene A, but the insulator blocks its effect on gene B Enhancer ll can stimulate th
    14·1 answer
  • During which step of meiosis do the pairs of homologous chromosomes split up, but the sister chromatids stay attached?
    9·1 answer
  • Which of the following statements describe how technology and research changed the understanding of genetics? Select all that ap
    14·2 answers
  • Is sickle cell anemia communicable disease or a genetic disorder?
    14·1 answer
  • HELP ME PLEASEEEEEEEEEEE
    6·1 answer
  • What is DNA like in a city?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!