1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lyrx [107]
3 years ago
14

3. If the solute concentration in the water is high (hypertonic solution), does water move

Biology
1 answer:
sdas [7]3 years ago
7 0

Answer:

its flows out

Explanation:

i hope ill help

:)

You might be interested in
Roughly how many times does earth rotate during each complete revolution
Alexus [3.1K]
23 hrs 56minutes and 4seconds to be precise
4 0
2 years ago
Which of the following is a function of the vertebral column? Select one: a. It supports the weight of the body. b. It allows sp
lisov135 [29]

Answer:

<h2>b. It allows spinal nerves to exit the spinal cord. </h2>

Explanation:

  • The vertebral column is an important characteristic of vertebrates.
  • The formation of the vertebral column takes place from the notochord in the vertebrate.
  • The vertebral column is also known as the spine or generally called the backbone.
  • It forms the spinal canal that is responsible to provide protection to the spinal cord.
  • The vertebral column is divided into many regions into human beings and some other organisms according to its function and position.
  • It has many functions such as protection of the spinal cord, allow passes of spinal nerves and some other.

5 0
3 years ago
Can a human make amino acids or does he or she have to always get amino acids from eating food?
meriva
Humans get amino acids from protiens in the food we eat. As we digest the food, the enzymes in our stomach and small intestines break down proteins into small amino acids. So technically, we do not make amino acids, we get amino acids from eating food high in protiens.
8 0
3 years ago
What does true breeding mean?
Anarel [89]
A true-breeding<span> organism, sometimes also called a purebred, is an organism that always passes down certain phenotypic traits (i.e. physically expressed traits) to its offspring.</span>
6 0
3 years ago
Read 2 more answers
How many possible combinations of 3 bases are possible
VashaNatasha [74]

The answer to your outstanding question is 3

6 0
3 years ago
Other questions:
  • What is the electron transport chain and where is it located?
    10·1 answer
  • Help me please!!!<br> identify two uses of nonrenewable resources shown in the picture
    7·1 answer
  • Based on the pyramid, which organism(s) provide the MOST available energy?
    10·2 answers
  • Binary fission
    10·1 answer
  • Identify the genotype for this pedigree chart
    10·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • PLEASE HELP ME WITH A BIOLOGY QUESTION !! IWLL GIVE BRAIN!,
    8·1 answer
  • Does anyone have snap if so type x if u want mine
    9·2 answers
  • Which type of population growth is shown on this graph?
    11·1 answer
  • Russell and Marco are trying to lift their friend Colin onto a tree branch. Russell is pushing
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!