I think your question all turn into lowercases, uppercases, and lowercases are important in genetics because it can differentiate between the dominant and recessive forms.
let me explain at least how to calculate the offspring percentage:
for example, you have Rr crossed with another Rr (R for wrinkled peas and r for smooth peas), you just have to match between the four letters, and you will have four possibilities:
R and R
R and r
r and R
r and r
you will have RR, Rr, Rr, and rr
if we convert into percentages, it will give:
25% RR
50% Rr (there's two Rr so 25 + 25)
25% rr
you could chose to describe the first graph as any of the following phrases:
‘curved graph’
‘intercept on y-axis’
‘as x increases, y increases’,
‘y increases slowly at first, then more rapidly, then slows down again’ and ‘reaches a maximum level’.
you can chose to describe the second graph as any of the following phrases:
'gradually increases, then rapidly increases in a short period of time"
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
