1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vredina [299]
3 years ago
8

What does the word Immigrant mean to you?

Biology
1 answer:
iragen [17]3 years ago
6 0

Answer:

someone who moved from a different country looking for job opportunities

Explanation:

You might be interested in
PLEASE HELP I WILL BE GIVING THE BRAINLIEST AND 15 POINTS!!!!!!!!
sineoko [7]
Hello again!

One limiting factor is the climate changes that the mammoths faced. They “stressed the mammoth population”

Another could be the humans as they arrived, the mammoths had gone extinct

Lastly the mammoths needed a lot of space as they were very big.

Hope this helped
5 0
3 years ago
How do protists help animals?
Mariana [72]
I think it just shows how many people care about the cause and think it’s important. It can also raise money and awareness about it.
5 0
3 years ago
U1:51:51
Vinvika [58]

Answer:tap in shorty

3 0
3 years ago
Read 2 more answers
Question 2
Lana71 [14]
Hierarchy - I don’t think I have the full context of the question but the word fits the best of its biology related
5 0
3 years ago
HELP ASAP WILL GIVE 10 POINTS PLEASEEE two populations of foxes are prevented from mating only because they live on two opposite
iragen [17]

Answer:

A geographic isolation

6 0
2 years ago
Other questions:
  • As each order of consumers eat other organisms, energy that transfers increases decreases stays the same.
    8·2 answers
  • If the fibers of a muscle are running caudoventrally, in which direction aRE they running?
    7·1 answer
  • 4. Suppose you knew the makeup of specific proteins in a cell. How would you determine the particular
    9·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • In addition tho the elements found in carbohydrates, proteins contain the element nitrogen. True or False.
    8·2 answers
  • Which process is characterized by the movement of particles from an area of high concentration to an area of low concentration a
    6·2 answers
  • What process do the animals (and plants) in the<br> rainforest use oxygen for?
    10·1 answer
  • Identifying the Structures of the Heart
    5·2 answers
  • Can someone please draw a flow chart of the Big Bang theory (not show) the scientific one (:
    12·1 answer
  • The double-helix structure of DNA:
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!