1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kamila [148]
2 years ago
8

A scientist is examining the function of macromolecules in a cell. She notices that movement of large molecules into and out of

the cell is disrupted when she damages one specific type of macromolecule.
Biology
1 answer:
Kipish [7]2 years ago
6 0

Answer:

 She notices that movement of large molecules into and out of the cell is ... and out of the cell is disrupted when she damages one specific type of macromolecule. ... The macromolecule which has she most likely damaged would be a protein.

You might be interested in
WILL MARK YOU BRAINLIEST!
Andreyy89
Which one all of the or what
7 0
3 years ago
Read 2 more answers
Which type of joint allows bones to move backward and forward in only one direction?
jok3333 [9.3K]
The type of joint that allows bones to move backward and forward in only one direction is the hinge joints. Ball and socket are the joints that allows movement in all directions. Gilding joints are type of joints that are the vertebral disks that allow twisting, turning, and sliding. Hinge joints are formed between two or more bones where the bones can only move along one axis to flex or extend. They include the ankle, elbow and knee joints.
5 0
2 years ago
Read 2 more answers
Enzymes can be re used?why?​
Anarel [89]

Answer:

Yes. Because:

Explanation:

Enzymes are not reactants and are not used up during the reaction. Once an enzyme binds to a substrate and catalyzes the reaction, the enzyme is released, unchanged, and can be used for another reaction.

4 0
3 years ago
Guys... I need answers ​
harina [27]

Answer:I have a question too HOW DO wait never mind sorry just keep reading please... ok how do I log out or switch accounts I really need to but it won’t let me congrats I wasted your time yay

Explanation:

5 0
2 years ago
Read 2 more answers
Un grupo de estudiantes utilizan un aparato para estudiar la tranferencia de energia durante la reaccion quimica entre pedazos d
NNADVOKAT [17]

Explanation:

It correctly reads;

A group of students use a device to study the energy transfer during the chemical reaction between pieces of eggshell (calcium carbon) and vinegar (acetic acid). During the experiment they use the same mass of eggshell but the concentration of the vinegar varies, (1%, 3% and 5%). Answer:

1. Explain why the energy transfer is not the same between the three tests of the experiment.

2. Describe how the device could be modified so that it can MORE ACCURATELY measure the energy transfer in each reaction.

5 0
2 years ago
Other questions:
  • The wind-chill effect refers to the fact that exposure to a cold environment can cause frostbite.
    9·1 answer
  • How many yards in 15 feet
    6·2 answers
  • Which of the following resources can replenish themselves by quick recycling and replacement , within a reasonable time , if man
    15·2 answers
  • Adaptions give organisms a better chance for
    5·1 answer
  • Which of these is a primary producer : tadpole, water snail, mosquito larvae, dragonfly nymph?
    15·1 answer
  • Which processes are directly responsible for the presence of the different species of wheat and corn shown in the diagram above?
    8·1 answer
  • Which of the possible examples below would most likely lead to a change in the cell theory?
    8·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which minerals are found in the igneous rocks gabbro and basalt
    10·1 answer
  • Which part of the DNA nucleotide contains the genetic code to make the protein?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!