1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kamila [148]
3 years ago
8

A scientist is examining the function of macromolecules in a cell. She notices that movement of large molecules into and out of

the cell is disrupted when she damages one specific type of macromolecule.
Biology
1 answer:
Kipish [7]3 years ago
6 0

Answer:

 She notices that movement of large molecules into and out of the cell is ... and out of the cell is disrupted when she damages one specific type of macromolecule. ... The macromolecule which has she most likely damaged would be a protein.

You might be interested in
The maximum mass of a white dwarf is _________.
sveticcg [70]
1.44 solar masses :) you are welcome
3 0
3 years ago
Describe two ways that people contribute to the spread of antibiotic resistance.
frosja888 [35]
People contribute to <span>antibiotic resistance by not completing their full course of antibiotics as prescribed by doctors when they are sick. This allows the bacteria to adapt to the antibiotic because the incomplete treatment did not kill the bacteria. Another way in which bacteria are becoming resistant to antibiotics is the widespread use of antibiotics in everyday consumer products, such as cleaners and beauty products. These antibiotics end up in the environment, and diluted exposure to these antibiotics by bacteria allows the bacteria to develop a resistance.   </span>
5 0
3 years ago
Help due tomorrow!!!
mamaluj [8]
Lemon juice is 10,000 more acidic than urine
4 0
4 years ago
A veces nos arrancamos trozos de piel – cuando nos quemamos por el sol o cuando nos recortamos las uñas. Si observamos estos fra
Phantasy [73]
Yo diría células y átomos
3 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Which item is responsible for joining nucleotides to build a new strand of DNA
    13·1 answer
  • The purpose of the mucus found within the respiratory system is to A. help move air through the windpipe. B. trap particles from
    13·1 answer
  • How did Cyanobacteria cool earth?
    8·1 answer
  • How do invasive species travel?
    14·1 answer
  • Create a Venn diagram comparing and contrasting plant and animal cells
    15·1 answer
  • Which refers to a macromolecule that forms as a result of the joining of multiple monomers?
    14·2 answers
  • An inherited advantageous trait that allows for greater survival and reproduction is refered as_____?​
    10·2 answers
  • Which of the following is not a true statement about the sun <br> PLEASE help
    8·2 answers
  • The chart below describes two different organisms living in the same ecosystem. Based on the information in the chart, which of
    14·1 answer
  • What type of syndrome is this Karyotype
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!