1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
2 years ago
10

8. Mr. Krabbs and his wife recently bad a Lil' Krabby, but it has not been a happy occasion for them. Mrs.

Biology
1 answer:
Yakvenalex [24]2 years ago
8 0

Answer:

Had this exact same question about 2 or 3 months ago.

1.) TT- 2 Tt-2 tt-0

2.) Yes because it is impossible for their baby to have short eyes because the short eyes trait (tt) is recessive, and using the Punnett Square, it shows that there is no way for them to have a baby with the short eyes trait.

Your Welcome

You might be interested in
How can someone prepare for losing sight?
ankoles [38]
Learn brail and test your hearing and smell.
6 0
3 years ago
Explain the relationship between correlation and causation.
ohaa [14]

Answer:

Correlation indicates that the two numbers are related in some way.

Causation requires more proof that there is no lurking variable that creates the relationship.

Explanation:

6 0
2 years ago
1. The structure of nuclear membrane is suitable for
frozen [14]
<h2>Answer:</h2>

<h3><em>OPTION</em><em> </em><em>B</em><em> </em><em>IS</em><em> </em><em>THE</em><em> </em><em>CORRECT</em><em> </em><em>ANSWER</em></h3>

<em> </em>

<h2>Explanation:</h2>

<h3>Nucleocytoplasmic exchange of materials</h3>

<h3>In eukaryotic cells, the nucleus is bound by a double membrane or nuclear envelope. It possesses openings at certain intervals called as 'nuclear pore'. Nuclear pores are large protein complexes regulates the exchange of material between nucleus and cytoplasm, i.e., nucleo-cytoplasmic exchange of materials. </h3><h3 />

6 0
3 years ago
Read 2 more answers
Which of the following statements are true regarding fatty acids?
zaharov [31]

Answer:

Option (I) and (IV).

Explanation:

Fatty acids may be defined as the carboxylic acid that contains the long aliphatic chain. Fats are generally of two types - saturated fatty acid and  unsaturated fatty acid.

The fatty acids are generally synthesized in the two carbon units. This helps in the proper synthesis of fat. The fatty acids that are most common in plants and animals are palmittic acid or the fats that contain  C16 and C18 species predominate.

Thus, the correct answer is option (I) and (IV).

4 0
3 years ago
An incomplete concept map of carrying capacity is provided.
baherus [9]

Answer:4

Explanation:

6 0
3 years ago
Other questions:
  • Which is considered the first stage of the cell cycle?
    13·2 answers
  • At one time, membrane biologists thought that transport proteins might act by binding a solute molecule or ion on one side of th
    12·1 answer
  • Describe the specialized characteristics of human red blood cells and explain how these characteristics help red blood cells to
    6·1 answer
  • Animals have tactile sensors located at different paths of their bodies. For example, cats have sensitivity in their __.
    13·1 answer
  • During the production of gametes, the chromosomes of a cell have condensed, and the chromatids of homologous chromosomes are cro
    13·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What brings greater concentrations of dissolved nutrients to the ocean surface?
    8·1 answer
  • 2. Which of the following is a function of chloroplasts?
    6·1 answer
  • High-latitude ocean water tends to support large planktonic communities because ________. of higher dissolved carbon dioxide the
    12·1 answer
  • HURRY PLEASE! :)
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!