1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bija089 [108]
3 years ago
5

Identify two properties of water and explain how each property allows water to play a large role in changing the Earth's surface

Biology
1 answer:
dem82 [27]3 years ago
4 0

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen

You might be interested in
The table above describes different types of chromosome disorders. Which diseases are caused by an extra chromosome?
Yuki888 [10]

The answer is (B) Edward's Syndrome, Down Syndrome, Klinefelter's Syndrome.

These syndromes are caused when there is an extra copy of chromosomes present in the cells.

In Edward's syndrome, there is an extra copy of the chromosome 18.

In Down's syndrome, there is an extra copy of chromosome 21.

In Klinefelter's syndrome, there is an extra copy of X chromosome.


3 0
3 years ago
Which scientist determined that electrons had predicted zones orbiting the nucleus? Rutherford Bohr Dalton Schrödinger
koban [17]

Answer:

Answer:Schrödinger

Explanation:

6 0
3 years ago
Read 2 more answers
Disinhibition of the lateral geniculate nucleus may be responsible for vivid visual hallucinations in what condition?
Ad libitum [116K]

Answer:

d) peduncular hallucinosis

Explanation:

One of the most striking symptoms of perpendicular hallucinosis is the existence of very vivid, colorful, and recurrent visual hallucinations. These hallucinations occur due to lesions of the brainstem and thalamus, which can influence a disinhibition of the lateral geniculate nucleus. The hallucinations provoked can be very debilitating for the person suffering from this illness and can completely disassociate him from reality.

4 0
3 years ago
The mass of an object is always
iVinArrow [24]

Answer:

equal to the sum of its parts.

Explanation:

Required

Which option answers the question?

The mass of an object is the total amount of matter in that object. When the term total amount in describing a concept, it means the summation of all its constituents.

In fact, that is the reason why the mass of an object is always constant because it is independent on gravity.

Take for instance, a brick.

Every part of the brick contribute to the mass of that brick and whenever the brick loses some of its part, either through wear and tear or any other means, the brick loses the mass of the lost part.

Hence, from the list of given options; option B is correct.

3 0
2 years ago
"the biggest concern with biological pollutants is that they often ____________."
andriy [413]
Lack predators and other natural controls
4 0
3 years ago
Other questions:
  • Organs, such as the stomach and the small and large intestines, are lined with smooth muscle tissue. These organs, due to the mu
    14·2 answers
  • Which process is occurring in this photograph of a glacier?<br><br> please and thanks!
    14·2 answers
  • A patient is seen for three extra visits during the third trimester of her pregnancy because of her history of pre-eclampsia dur
    10·1 answer
  • How do the crystals in a metamorphic rock align if the rock has been exposed to extreme pressure?
    7·1 answer
  • As a car is driven around burning gasoline what is released into the atmosphere
    5·2 answers
  • 8. Cystic fibrosis is caused by a recessive allele. The frequency of this allele is 0.1 in a population of 2,500.
    12·1 answer
  • Where do sensory nerve cells, parasympathetic ganglia, and symphathetic postganglionic fibers found?
    13·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Help???????????????????
    6·1 answer
  • Pesticides are chemicals that are often sprayed on crops to kill plant-eating insects, preventing damage to the crops. WHile pes
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!