Answer and Explanation
Due to technical problems, I was not able to fill the answer and explanations in the corresponding boxes. You will find them in the attached files.
Maintaining a healthy lifestyle through diet and exercise is important because the world is rapidly advancing and this rapidness has brought many health concerns. Today's lifestyle is extremely stressful for any age group and without proper diet and exercise, one cannot cope up with his/her daily routine.
<h3>Benefits of Diet and Exercise:</h3>
- It helps in dietary nourishment and proper intake of nutrients.
- Exercising keeps a check on calorie intake.
- Proper supplements with exercise helps in muscle development and removal of bad body fat.
- A person with a good diet and regular exercise can attain good physical and mental well-being.
To learn more about maintaining a healthy lifestyle through diet and exercise, refer:
brainly.com/question/25814640
#SPJ2
Answer:
Most athletes' regular diets provide ample protein. Even if there is an increased need for protein in a particular sport, the increases are easily met by their typical diet. Intakes of additional protein beyond the recommended levels for athletes' does not increase strength or enhance performance.
Explanation:
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
