1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksian1 [2.3K]
3 years ago
12

How does the burning of fossil fuels contribute to climate change?

Biology
1 answer:
borishaifa [10]3 years ago
8 0

Answer:

<h3>When fossil fuels are burned, they release large amounts of carbon dioxide, a greenhouse gas, into the air. Greenhouse gases trap heat in our atmosphere, causing global warming.</h3>
You might be interested in
Why might chlorine be added to drinking water?
Effectus [21]
1 reason is to kill disease in water
3 0
3 years ago
Give one example of a molecule using passive transport and one example of a molecule using active transport.
ruslelena [56]

One example of passive transport is diffusion, when molecules move from an area of high concentration (large amount) to an area of low concentration (low amount). Molecules are said to naturally flow down their concentration gradient

6 0
3 years ago
Insects are the most diverse group of organisms, in terms of numbers of species, dominating terrestrial habitats.
Igoryamba
It’s true, there are more insects than there are any other specie and more kinds
3 0
3 years ago
A paleontologist has recovered a bit of tissue from the 400-year-old preserved skin of an extinct dodo bird. The researcher woul
slava [35]

Answer:

c)polymerase chain reaction (PCR).

Explanation:

Because the paleontologist recovered only a bit of tissue  and it is very old, it is very likely that the DNA in the sample is very small and part of it is degraded. Anyway, the paleontologist must first amplify the DNA sample to obtain many identical copies of the specific region of the DNA they want to compare. the above is done through a polymerase chain reaction (PCR).

8 0
3 years ago
All _____ stimuli and responses are unlearned, such as salivating at the sight of food.
Debora [2.8K]
It is a. Unconditioned ;)
8 0
3 years ago
Other questions:
  • In which type of reproduction can cells divide through the process of mitosis
    8·1 answer
  • Which benefits do mangrove trees provide to surrounding coastal wetlands? Check all that apply.
    7·2 answers
  • What stage of cellular respiration use the high-energy electrons from NADH and FADH2 to form ATP molecules
    13·1 answer
  • Predict what would happen if a plant from a deciduous forest were transplanted to the tundra. Explain
    6·1 answer
  • Why is high milk production a desirable trait?
    15·1 answer
  • Help me out with this​
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What is a closed circulatory system
    5·1 answer
  • As a dental assistant you are responsible for mounting radiographs, what are helpful hints when
    14·1 answer
  • What is the DEPENDENT variable in this experiment? (Hint: What depends on the independent variable?)
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!