1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Goshia [24]
3 years ago
9

Do water molecules speed up or slow down

Biology
2 answers:
balu736 [363]3 years ago
7 0

Answer:

In its liquid form, water molecules move around slowly, sliding past each other.

Explanation:

jarptica [38.1K]3 years ago
3 0

Answer:

If its liquid form they move slow but if its ice they move fast

Explanation:

You might be interested in
Place the ruler over the sphere. What is the diameter of the sphere?
GarryVolchara [31]

Answer:

The formula for the volume of a sphere is V = 4/3 πr³. See the formula used in an example where we are given the diameter of the sphere.

Explanation:

3 0
2 years ago
answer these quiestons based on what you learned from the lesson. are a relatively small group of bacteria
vlada-n [284]

Answer:

The answers for the question are:

  1. Archaebacteria
  2. Eubacteria
  3. Shape
  4. Cocci
  5. Bacilli
  6. Spirilla
  7. Bacteria

Bacteria are little single-celled living beings. Microscopic organisms are found nearly all over on Soil and are imperative to the planet's biological systems.

  1. Archaebacteria - are a relatively small group of bacteria that thrive in extreme conditions
  2. Eubacteria - are a diverse group of bacteria that sometimes make us sick.
  3. Eubacteria are classified by Shape.
  4. Cocci -are round bacterial cells.
  5. Bacilli - are rod-shaped bacterial cells.
  6. Spirilla -are spiral-shaped bacterial cells.

Learn more about "Bacteria":

brainly.com/question/11959239

Please Mark Brainliest If This Helped!

6 0
2 years ago
Based on the chart, Which system interactions are dependent on the plant's ability to respond to the direction of
otez555 [7]
Ether 1 or 3 but I would say 1
8 0
2 years ago
Mafic lava tends to have low silica content. Based on this, which of the following statements about mafic lava is most likely tr
sashaice [31]

Answer:

A. It contains fewer volatile gases.

Explanation:

Mafic lava have a composition of about 45-55% silica with high amount of Fe, Mg, Ca.

The silica content is quite low compared to those of granitic magma whose silica content can reach up to about 60%.

What determines the viscosity of magma is basically the silica content of the magma and the temperature of the magma. Viscosity is the resistance to flow.

The higher the silica content, the lower the viscosity and the higher the amount of volatile gases. Such type of magma is the granitic magma. Granitic magma due to their viscosity flows slowly.

The lower the silica content, the higher the viscosity and the lesser the presence of volatile gases in them. Such an example is Mafic magma. Mafic magma flows very slowly with low amount of dissolved gases.

8 0
3 years ago
Read 2 more answers
How might the fatty deposit and the arterial wall affect the nervous system ?
emmasim [6.3K]
It put stress on the nervous system.
4 0
2 years ago
Other questions:
  • When hooke first used the term cell did he intend to have it apply to living material
    14·2 answers
  • The mismatch of DNA base pair during duplication can result in mutation true or false
    9·2 answers
  • What is the difference between osmosis and diffusion?
    14·2 answers
  • Observations of organisms include
    9·2 answers
  • Can a scientific inquiry be constructed about any question?
    11·1 answer
  • Which of the following would produce a silent mutation?
    5·2 answers
  • What process creates mRNA?
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What is the function of DNA and where is it found in a eukaryote cell
    6·1 answer
  • PLEASE HELPPP
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!