1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adell [148]
3 years ago
9

Calculate the acceleration of a ball has been dropped from the roof. It accelerates from 10 m/s to 30 m/s in 2 sec. 1 point 15 m

/s/s 10 m/s/s 5 m/s/s
Biology
1 answer:
Andre45 [30]3 years ago
4 0

Answer:

10 m/s/s or m/s²

Explanation:

Acceleration can be calculated by using the formula;

a = v - u/t

Where;

a = acceleration (m/s²)

v = final velocity (m/s)

u = initial velocity (m/s)

t = time (s)

In other terms, acceleration (a) can be represented as ∆V/t.

According to this question, a ball accelerates from 10 m/s (u) to 30 m/s (v) in 2 seconds. Hence, the acceleration of the ball is as follows:

a = 30 - 10/2

a = 20/2

a = 10m/s².

You might be interested in
Integrated natural resource management (INRM) is MAINLY concerned with the management of A) minerals. B) fossil fuels. C) land a
sammy [17]
The correct answer is letter c. land and water.

INRM or also known as Integrated Natural Resources Management is a systematic process or way to manage our natural resources, such as land and water. Land and Water are two major natural resources in our planet.
8 0
3 years ago
At the END of the experiment, a. side A is hypertonic to side B. b. side A is hypotonic to side B. c. side A is isotonic to side
SpyIntel [72]

Answer:

side A is hypotonic to side B.

Explanation:

7 0
3 years ago
Active transport differs from passive transport in that energy in the form of ____ is used to move molecules across the membrane
mario62 [17]

Answer:

ATP

Explanation:

ATP is the type of energy needed for active transport to take place.

6 0
3 years ago
Need help please and thanks
schepotkina [342]

Answer:

1)double 2) nitrogen bases 3)sugar and phosphates 4)guanine

Explanation:

just trust me

7 0
3 years ago
populations around the globe. If you were a scientist studying this fungus and wanted to know if it could infect a new frog spec
11111nata11111 [884]

Answer:

Two arm Experiment

Explanation:

They will make two arms or groups. In one group they will introduce the fungus and in another they wont and will observe both group to see if the group that was introduced with fungus get infected or not

3 0
4 years ago
Other questions:
  • What is considered a Growing ovary
    15·1 answer
  • when the gravitational pulls of the sun and moon partially cancel each other out,Earth experiences a _____tide.
    15·2 answers
  • This part of the cell is made up of a carbohydrate called cellulose
    9·2 answers
  • In what type of circulation does the blood flow between the heart and lungs?
    5·1 answer
  • 8. Which of the following can be expressed as a mathematical formula?
    7·1 answer
  • Cual es la causa para que los oceanos se expanden entre 3 y 10 cm por año
    5·1 answer
  • If the average length of a double helix in human chromosome is 3.9 cm, approximately how many base pairs are present in such chr
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Bailey designed a science fair experiment to test the effect of different light sources on the growth of rose plants. To conduct
    9·2 answers
  • Which of the following makes its gravitational pull increase ?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!