1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
4vir4ik [10]
3 years ago
11

_____ is an enzyme that has the capacity to add dna to shortened telomeres, rebuilding and extending the length of telomeres.

Biology
1 answer:
Andreas93 [3]3 years ago
8 0
I need more hel for the simple razon
You might be interested in
How would you know if your results from experiment 2 show that the traits were inherited through mendelian genetics?
Karolina [17]
Genes they assort independently if they follow the 9: 3: 3: 1 rule resulting from a dihybrid cross.
It shows that the genes are not on the same chromosome and they are not included.
8 0
3 years ago
Read 2 more answers
ASAP!! I WILL MARK YOU BRAINLIEST!!! I JUST NEED THE ANSWER!!! How are photosynthesis and cellular respiration related?
nydimaria [60]
The both add CO2 to the atmosphere
5 0
2 years ago
How are a straightedge and compass used to make basic constructions?
Schach [20]

Answer: they are used to measure and keep things precise during constuction

Explanation: because if you watch videos and look up info and research it tells you about their jobs and what they use for their jobs

7 0
2 years ago
What did the experiments of Griffith and Avery show about genetic information ?
juin [17]

Answer:

Griffith and Avery studied bacteria and mice. Their S and R experiment revealed that DNA stores and transmits genetic information from one generation of bacteria to another. Chromosomes consist of protein and DNA, but mainly DNA.

Explanation:

8 0
3 years ago
Since viruses are typically 20-200 nm in diameter, the ____ microscope is best for viewing them.
tatyana61 [14]

Electron is the best way for viewing them

3 0
3 years ago
Read 2 more answers
Other questions:
  • Plssss help me on this
    10·2 answers
  • Identify the independent and dependent variables in the following sentence: Joan is collecting data on gender differences (male,
    7·2 answers
  • The process by which the particles of a gas randomly pass through a tiny opening is called
    15·1 answer
  • In northeast kansas there is a creature know as a wildcat. it comes in three colors, blue, red, and purple. this trait is contro
    9·1 answer
  • Specify the three main types of aquatic ecosystems.
    9·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • How does the neuroendocrine system maintain homeostasis in the body?
    11·2 answers
  • The endosymbiotic theory suggests that a prokaryotic cell ate another prokaryote, giving rise to eukaryotes.
    12·1 answer
  • What are the functions of each layer of the atmosphere?
    14·1 answer
  • The reaction that creates ATP from ADP and Pi is energetically unfavorable. That means that it requires energy to carry out the
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!