1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dimas [21]
3 years ago
14

Which program is an example of domestic policy?

Biology
2 answers:
Alinara [238K]3 years ago
5 0
Answer:

business and education
Alika [10]3 years ago
3 0
Business, education, healthcare, law enforcement, etc..
You might be interested in
Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
Svetllana [295]

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

8 0
3 years ago
A plant cell differs from an animal cell in that the annual cell does not have?
Dmitry [639]
The animal call does not have a cell wall
3 0
3 years ago
How is the way a dog looks at a face similar to the way humans look at faces
GarryVolchara [31]

Answer:

ever wonder if your dog really really loves you — or if he’s just in it for the kibbles?

Alas, scientists haven’t figured out exactly how our dogs feel about us. But a study published this week in the journal PLOS One has yielded fresh insight into how dogs see us. It adds to existing research showing that — much like humans, other primates and even goats — our canine friends use specific regions of their brain to “process” our faces.

“Our study provides evidence that human faces are truly special for dogs, as it involves particular brain activity,” study co-author Dr. Luis Concha, an associate professor at the National Autonomous University of Mexico’s Institute of Neurobiology, told The Huffington Post in an email. “To dogs, the human face is no ordinary thing.”

Explain:

5 0
3 years ago
Read 2 more answers
Sort the characteristics of solids, liquids, and gases into the correct columns
IRINA_888 [86]

Answer:

Explanation:

Solids-atoms vibrate in place, there is a definite shape/volume; Liquids-atoms slide around, there is a definite volume only; Gases-atoms are spread far apart, with no definite shape/volume. Hope this helps.

8 0
3 years ago
Read 2 more answers
Does anybody know HKW to look up someone’s name on here or anything? I’m trying to find my friend
Scilla [17]

Answer:

<em>Oh i think if you search for your friend then I think it will come... I THINK!! I am not sure... Sorry if I am wrong... I am trying to answer all the question properly.</em><em> </em><em>Have </em><em>a </em><em>nice </em><em>day:</em><em>)</em>

8 0
3 years ago
Other questions:
  • HELP!!!!! pls I’m getting mixed answers of B and C!
    9·2 answers
  • White meat contains (less/more) myoglobin than red meat, Red meat contains more (slow/twitch) muscles than white meat does.
    15·1 answer
  • When subjected to heat and pressure,a chemical sedimentary rock can be changed into which rock type?
    12·2 answers
  • Compare and contrast lactic acid fermentation and ethanol fermentation (alcohol fermentation). move each phrase to the appropria
    10·1 answer
  • Please help ASAP, thanks!
    10·1 answer
  • PLS HELP SOMEONE PLS!!!! 99 POINTS!
    7·1 answer
  • How do these equations explain why the total amount of O2 and CO2 remains the same?
    9·1 answer
  • When an injury occurs that causes blood to be lost, the body detects the reduction in blood volume and induces a vascular spasm.
    8·1 answer
  • Help plz for the 3 of emmm!<br> Plzzzz and thank you!
    8·1 answer
  • Which of the following make up a nucleotide?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!