Answer:
50
Explanation:
There are actually 58, but the closest approximation here is 50
S waves are slower than P waves and they can only travel through solid rock. S waves move the particles it pushes through up and down or side to side (perpendicular to the motion of the S waves energy).
You didn't attached the choice but then I have two answer either of the two is correct. The first one is Putamen , is located on the base of the telencephalon (forebrain). Second answer is Angular gyrus is a region part of the brain and it is involved in number of processing related to number processing and spatial cognition, language, attention and memory retrieval.
Answer:
Here are seven theories complied by the science daily LiveScience which suggests the origins of Life.
1 Panspermia.
2 Simple Beginnings. ...
3 RNA World. ...
4 Chilly Start. ...
5 Deep-Sea Vents. ...
6 Community Clay. ...
7 Electric Spark. ...
Explanation:
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
