1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yulyashka [42]
3 years ago
8

What is a cell wall ? (Short and specific answer) PLEASE !!

Biology
1 answer:
Delvig [45]3 years ago
4 0
It is a wall that protects the plant cell.
You might be interested in
How many atoms are in a 70 kg human?
topjm [15]

Answer:

7 followed by 27 zeros

Explanation:

The body of an adult man weighing 70 kg is made up of approximately 6.7 • 10 ^ 27 atoms.

The body of an adult male contains approximately 57% water, but if we look by weight, hydrogen is only 11%, while if we look at the mutual ratio of atoms in water, there are a total of 67% hydrogen atoms.

In this way, most of the weight (mass) of the human body comes from oxygen, but most of the atoms in the body are hydrogen.

4 0
3 years ago
All blood vessels containing oxygenated blood are colored red EXCEPT for ?
dusya [7]

Answer:

deoxygenated blood i think

Explanation:

4 0
2 years ago
Read 2 more answers
which source of energy is normally used for short bursts of energy? Lipids. Protein. Glycogen. Lactic acid.
Brut [27]
The answer is glycogen<span />
7 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Which elements make up molecules of sugar
mestny [16]
Sugar is sucrose and a carbohydrate. It's made up of 3 elements. 12 atoms of carbon, 22 atoms of hydrogen, and 11 atoms of oxygen. (C^12H^22O^11)
3 0
3 years ago
Read 2 more answers
Other questions:
  • A pure substance has a/an _______ composition.
    12·2 answers
  • What is the difference between refraction and reflection
    14·1 answer
  • What organ releases glucose to help maintain normal blood glucose levels?
    5·1 answer
  • How does loss of biodiversity affect the biosphere
    15·1 answer
  • 1. Explain why species that overlap a great deal in their fundamental niches have a high probability of competing. Now explain w
    10·1 answer
  • Relative to a body of cooler air, a body of warm air would be: <br><br> A. Moist<br> or<br> B. Dry
    13·1 answer
  • The picture shows an organ system in the human body
    13·2 answers
  • The skeletal and muscular systems of human are shown above. List three systems,
    14·1 answer
  • Can you help me please
    14·1 answer
  • True or false: We have the same number of chromosomes as mosquitoes
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!