1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klasskru [66]
3 years ago
11

As a research scientist, you measure the amount of ATP and NADPH used by the Calvin cycle in 3 hours. You find 9,000 molecules o

f ATP used, but only 6,000 molecules of NADPH. Where did the extra ATP molecules come from
Biology
1 answer:
Vadim26 [7]3 years ago
6 0

Answer:

The correct answer is - Cyclic flow.

Explanation:

Cyclic electrons flow pumps proton in the lumen of thylakoid towards the concentration with the help of ATP synthase. This movement produces additional ATP.

These additional ATPs are come from cyclic electron flow, during light reaction come from cyclic electron flow, during light reaction.

You might be interested in
The conversion of liquid water into gaseous water is called?
Scilla [17]

Answer:

vapourization

Explanation:

When the water is heated, it changes into water vapour which is called vapourization or sometimes we can also call it evaporation.

5 0
2 years ago
In a fixed volume when temperature increases , pressure does what?
Leni [432]

<u>Answer:</u>

<em>When the volume is constant the pressure increases with temperature.  </em>

<u>Explanation:</u>

<em>Gay Lussac’s law precisely explains the relation between pressure and temperature of a system which has constant volume.</em> In a system which has constant volume an increase in temperature indicates increase in temperature as well.

The reason behind the observation of this trend is the change in <em>randomness of particles of the system.  </em>

With increase in temperature the particle movement becomes random and fast. <em>The particles hit the container walls at an increased rate and the pressure of the system increase.  </em>

3 0
3 years ago
Question 3
natka813 [3]

Answer:

besh cornerhiiiiiiiiiiiiiiiii

4 0
2 years ago
Choose the arteries in the order that an erythrocyte passes through traveling from the aorta to the brain: (1) Basilar artery, (
Harlamova29_29 [7]

Answer:

The sequence order of the arterial vessels in the order leading from the aorta to the brain is: 2,4,5,1,3.

Explanation:

Correct Answer: In order, the sequence of vessels leading from the aorta to the brain is: 2,4,5,1,3.

2 -The brachiocephalic artery (same as brachiocephalic trunk and innominate artery) is an artery found in the mediastinum region where blood is supplied to the right arm and the head and neck

4 - The right subclavian artery arises from the arch of the aorta directly which is a branching of the brachiocephalic trunk and is on the left lies posterior to the insertion of the scalene muscle anterior on the first rib.

5 - The vertebral arteries are arteries majorly of the neck. Usually, this arteries originate from the subclavian arteries. It functions so as to supply the vertebrobasilar vascular system, thks vertebral arteries supply blood in this order to the upper spinal cord, brainstem, cerebellum, and posterior part of brain.

1- Meanwhile basilar artery carries oxygenated blood from 5 to the cerebellum, brainstem, and occipital lobes.

3 - Several arteries at the bottom (inferior) side of the brain is called Circle of Willis and it is the joining area of several arteries in the brain. Branching of smaller arteries from the Circle of Willis happens here as internal carotid arteries that supply oxygenated blood of more than 80% of the cerebrum.

7 0
3 years ago
Read 2 more answers
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • persenyawaan dan perbedaan apakah yang ada antara proses perbuatan roti dan proses pembuatan bir ? jelaskan!
    13·1 answer
  • What are the four codons for threonine
    14·1 answer
  • D4 Science)<br> 7. Where do you find membrane-bound organelles?
    12·1 answer
  • Cual es la ?disciplina que se encarga de las reglas de clasificacion?
    9·1 answer
  • Which of these naturalists synthesized a concept of natural selection independently of darwin?
    5·1 answer
  • Bacteria that live around deep-sea, hot-water vents obtain energy by oxidizing inorganic hydrogen sulfide belched out by the ven
    13·1 answer
  • A palpable pulse that presents with a chaotic rhythm and no predictable pattern is​ called:
    6·2 answers
  • Pioneer species are found in area's
    7·2 answers
  • Sister chromatids separate from each other and are pulled to opposite sides of the cell in Meiosis I during:
    8·2 answers
  • Write a paragraph explaining how adhesion cohesion and capillary action all enable water to go from the roots to the top of the
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!