Thee answer is (deposition of sediment).
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Maybe like a granola bar because granola bars is an easy quick and go
The possible energy sources for muscle contraction from the list include:
<h3>What is Energy?</h3>
This is referred to as the ability to do work and the major fuel in the body is referred to as glucose.
Glycogen in muscles also acts as a fuel although its synthesis is usually very slow.
Read more about Energy here brainly.com/question/13881533
#SPJ1
It is B it acts as a Shield to block the uv rays
