1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melamori03 [73]
3 years ago
7

Are the fatty acid tails saturated or unsaturated?

Biology
1 answer:
valkas [14]3 years ago
8 0

Answer:

The fatty acid tails saturated or unsaturated is discussed below in details.

Explanation:

Fatty acids contain a carboxylic acid association and a great hydrocarbon series, which can either be saturated or unsaturated. A saturated fatty acid tail only contains carbon-carbon individual bonds, and an unsaturated fatty acid has at the slightest individual carbon-carbon twice or triples bond.

You might be interested in
During photosynthesis in plants, sunlight is captured by the chlorophyll to produce glucose. What is the source of the carbon in
Nata [24]

Answer:

I believe it is Carbon-dioxide

Explanation:

6 0
2 years ago
Read 2 more answers
Which of the following best describes succession?
Gwar [14]

i think it is B or A they make the more sense hope this helps ✌

8 0
3 years ago
What is the term for a group of organisms of the same species living in a particular area
brilliants [131]
Pretty sure it is a population 
7 0
4 years ago
While excavating an area in the desert, a scientist discovers the fossils of very large tress and ferns. What might the scientis
Whitepunk [10]
Large trees and ferns need water to survive. This suggests that the biome was once very different from the desert it is today. #globalwarming lol
8 0
4 years ago
Question 20 , please help:(
Alika [10]
I believe it is b. The rest don’t really work or make sense
3 0
3 years ago
Other questions:
  • Can enzymes be used to help any reaction
    7·2 answers
  • A man has mutations in his skin cells from excessive sun exposure. These mutations will not
    12·2 answers
  • Non-avian reptiles can produce hyperosmotic urine using which structure?
    15·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • The chloroplast functions in:
    14·1 answer
  • All individuals have two alleles for a given trait. According to Mendel's Law of Segregation, these alleles are passed down one
    12·2 answers
  • 14. Describe each of the following properties of water…
    13·1 answer
  • What are three functions of a starfish's water vascular system?
    11·1 answer
  • Why does oxygen from our lungs diffuse into the bloodstream?
    14·1 answer
  • What did Robert Virchow observe when he witnessed a cell dividing in half?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!