1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio [31]
2 years ago
15

As shown in the diagram above, at several locations warm, less dense water cools

Biology
2 answers:
shepuryov [24]2 years ago
4 0
I don’t see a diagram
KengaRu [80]2 years ago
3 0
What exactly are you trying to ask ??
You might be interested in
According to Newton’s third law of motion, which of the following best describes the forces of the tennis racket and the ball?
-BARSIC- [3]

Answer:

Newton's third law of motion is For every action, there is an equal and opposite reaction.

Explanation:

So if you throw a tennis ball and then hit it with a tennis racquet then the action would be the tennis ball and the equal and opposite reaction woul be the tennis ball bouncing off of the tennis racquet.

5 0
3 years ago
How many types of genes are there? Name them.
kherson [118]

Answer:

Where my dear i don't know what you saying

4 0
2 years ago
Read 2 more answers
Which of the following describes organelle structures that plant and animal cells have in common?
harkovskaia [24]

Answer: nucleus, Golgi complex, endoplasmic reticulum, ribosomes, mitochondria, peroxisomes, cytoskeleton, and cell (plasma) membrane

Explanation:

5 0
3 years ago
Read 2 more answers
In order to make a protein the messenge on DNA must be converted to what?
Soloha48 [4]

Explanation:

-mRNA or messenger RNA

DNA wound into chromosomes within the nucleus is unwound, unzipped and read by enzymes in a complex series of steps known as transcription. The message on DNA, called genes is copied by RNA polymerase, to form mRNA complementary sequence to that of the DNA strand.

Further Explanation:

Nucleic acids are comprised of smaller units called nucleotides and function as storage for the body’s genetic information. These monomers include ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). They differ from other macromolecules since they don’t provide the body with energy. They exist solely to encode and protein synthesis.

  • Basic makeup: C, H, O, P; they contain phosphate group 5 carbon sugar, these nitrogen bases which may contain single to double bond ring.

Nucleic acids like DNA stores all of an organism’s genetic information. Nucleic acid molecules comprise the nitrogenous bases Guanine, Adenine, Cytosine and Thymine. Conversely, RNA nucleotides are Adenine, Guanine, Cysteine and Uracil. These pair up as base pairs due to their varied structure- largely influenced by the location of N molecule.  

In certain combinations, these bases form codons which act as instructions for protein synthesis. Codons are three nucleotide bases encoding an amino acid or signal at the beginning or end of protein synthesis.

RNA codons determine certain amino acids, so the order in which the bases occur within in the codon sequence designates which amino acid is to be made bus with the four RNA nucleotides (Adenine, Guanine, Cysteine and Uracil). Up to 64 codons (with 3 as stop codons) determine amino acid synthesis. The stop codons ( UAG UGA UAA) terminate amino acid/ protein synthesis while the start codon AUG begins protein synthesis.

Thus, these contribute to the broad diversity of living organisms, as varied combinations of these 64 codons can produce many proteins which can be organized into cells, tissues and organisms.

Learn more about transcription at brainly.com/question/11339456

Learn more about DNA and RNA at brainly.com/question/2416343?source=aid8411316

#LearnWithBrainly

7 0
3 years ago
Which substances are outputs of photosynthesis?
Vilka [71]

Answer:

In photosynthesis, water, carbon dioxide, and energy in the form of sunlight are inputs, and the outputs are glucose and oxygen.

Explanation:

3 0
3 years ago
Other questions:
  • We have about ______ as many genes as a fruit fly.
    6·1 answer
  • Independent assortment of chromosomes is a result of24)A)the random nature of the fertilization of ova by sperm.B)the random dis
    14·1 answer
  • Carbon chains are principal features of both carbohydrates and lipids.what is the primary difference between these two types of
    8·1 answer
  • An example of a producer is
    11·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • You forgot to ask a friend to water your plants while you were on vacation. When you got home you noticed they were wilting. Wha
    8·2 answers
  • Geothermal energy consists of:
    13·1 answer
  • To ensure contamination from utensils and preparation equipment is eliminated
    12·1 answer
  • Hii..
    15·1 answer
  • Is mitochondria a plant cell animal cell or both
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!