1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naya [18.7K]
3 years ago
7

what term refers to a situation where a single phenotypic character is determined by the additive effects of two or more genes?

Biology
1 answer:
vampirchik [111]3 years ago
5 0

Answer:

Explanation:

Polygenic inheritance refers to a situation where a single phenotype character is determined by the addictive of two or more genes.

hope it helps :)

You might be interested in
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
2 years ago
Protein digestion begins in the stomach where hydrochoric acid denatures protein and pepsin breaks down protein.
sergeinik [125]

Answer:

True

Explanation:

Check your books/notes/lectures to verify

5 0
3 years ago
What two elements have the same number of energy level (shells)?
melomori [17]

Answer:

Elements that are found in the same horizontal row (belong to the same period) in the periodic table, e.g. Fluorine and Neon both have the same energy level of 2.

<em>Note: The question does not specify any two elements.</em>

Explanation:

The modern periodic table is organized into eight vertical columns known as groups and seven horizontal rows known as periods. The atomic number ( number of protons in the nucleus) of elements increases when moving across the periodic table from left to right. The horizontal rows or periods represents an energy levels or the number of electron shells in an element. Energy levels (also called electron shells) are fixed distances from the nucleus of an atom where electrons may be found. Elements belonging to the same period have the same number of energy level or shells. For example, the elements belonging to Period 2 include lithium, beryllium, boron, carbon, nitrogen, oxygen, fluorine and neon. These all have the same number of energy level of 2.

7 0
3 years ago
Suppose an animal is heterozygous AaBb, and the traits are not linked. When meiosis occurs, what is the total number of possible
GrogVix [38]

Answer:

4 possible combinations of gametes

Explanation:

The animal is considered an heterozygotic dihybrid because it involves two genes that have different alleles for both genes. The dihybrid animal undergoes meiosis to produce gametes. According to Mendel in his laws of segregation and independent assortment, the alleles of the two genes separate into gametes independently of one another to produce 4 types of gametes.

Number of possible combinations of gametes formed by an heterozygote can be determined by using 2^n, where n is the number of characters. Number of characters or genes involved in this case is 2, Hence, 2^2 = 4 gametes.

The allelic combination in the four gametes are: AB, Ab, aB, ab.

7 0
3 years ago
Which gland stimulates the immune system?
ahrayia [7]

Answer:

Thymus gland

Explanation:

it is active during puberty mostly and after slowly shrinks

7 0
3 years ago
Other questions:
  • Which was the normal household pattern in early china?
    14·1 answer
  • Which nutrient supplies the medium in which chemical changes in the body occur?
    6·1 answer
  • Which statement BEST describes what occurs to a molecule of the enzyme trypsin AFTER it binds to a molecule of protein? A) After
    7·2 answers
  • Staphylococcus aureus has become resistant to penicillin, methicillin, and now possibly to vancomycin. Since bacteria do not sex
    11·1 answer
  • When dna is _____________, the genes within it tend to be inaccessible and silent; that is, they rarely code for protein?
    7·1 answer
  • In general, what happens to the number of organisms as you move up levels
    12·1 answer
  • For separate ecosystems to be classified as the same type of biome they must
    14·1 answer
  • Photosynthesis and respiration depend on each other for the exchange of:
    8·2 answers
  • A recipe for sugar cookies calls for an oven to be preheated to 175c, evaluate which of the following answers are the equivalent
    11·1 answer
  • What is the role of transport proteins in the cell membrane
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!