1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sunny_sXe [5.5K]
3 years ago
12

Review the following chart. Use sequencing to shape a summary of the main ideas. Be sure to show the effects on other animals an

d humans. Where does the cycle stop?
The Cycle of Cause & Effect in Bovine Spongiform Encephalitis
A flowchart. Cow is fed infected meat from felled animals. The cow develops B S E. May or may not show symptoms. If the cow dies from B S E, cow is slaughtered or dies. Waste products fed to other animals, which repeats the cycle. If the cow is slaughtered and sold as meat for humans, human develops C J D, the human form of B S E. Human dies from C J D and the cycle is broken.

Geography
2 answers:
Vikentia [17]3 years ago
8 0

Answer: just put it in the right order and the cause and effect wht grade u in u never learned cause and effect?

Explanation:

zhenek [66]3 years ago
7 0

Answer:

The cycle stops with people dying because of a disease that is found in cows.

Explanation:

You might be interested in
Someone please help me
Cerrena [4.2K]

time sheduals are changing , so the times MIGHT get more innacuratly placed

6 0
3 years ago
How is fear used to influence the viewer to buy victory
Arlecino [84]

<em><u>It shows spooky, shadowy hands trying to grab at a baby.</u></em>

<em><u>It shows a mother holding her baby close </u></em>

<em><u>It uses exclamatory text to imply the need for protection.</u></em>

<em><u>Dit boldly tells the viewer to buy victory bonds.</u></em>

Answer: Option 1, 2, 3 & 5

<u>Explanation:</u>

Victory bonds were the bonds which were like a loan given to the country of the government by the citizens for them to bear the expenditure of the war. These bonds could be redeemed by the citizens who have bought them only once the war gets over.

Even interest was paid on these bonds at the time of redemption of these bonds. These were meant for the victory of the country in a war thus named victory bonds. Pictures showing spooky hands to grab a baby or using exclamatory texts or directly telling the people to buy it were used to make people buy these.

5 0
4 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
The population of Russia is 5 x larger than the population of the UK true or false???
dimaraw [331]

Answer:

False

Explanation:

Russia is the largest country in the world but is sparsely populated

3 0
3 years ago
Which of the following best describes a steppe
omeli [17]

a large area of flat unforested grassland in southeastern Europe or Siberia

6 0
4 years ago
Read 2 more answers
Other questions:
  • All rectangles are similar because they have congruent corresponding angles (all right angles).
    12·1 answer
  • Which statements below describe the European Union (EU)? Select all that apply.
    6·2 answers
  • How can a global dependence on fossil fuels have associated social costs?
    9·2 answers
  • Southeast Asia is bordered by __________. A. Africa, the Mediterranean Sea, and the Atlantic Ocean B. China, the Pacific Ocean,
    11·2 answers
  • Would a Coca- Cola bottling plant be located near consumer or clustered in one region of the U.S? Explain
    6·1 answer
  • What is a growth point(In geography)
    14·1 answer
  • Why is it necessary to seek permission during preparation of a fieldwork
    8·1 answer
  • What argument is James making in this speech
    15·2 answers
  • what is the name of the capital city of Indonesia and what countries have colonized Indonesia also explain about the typical cul
    12·2 answers
  • The relationship among the locations of volcanoes, earthquake epicenters, and mountain rangesmultiple choice questions and answe
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!