1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irina1246 [14]
3 years ago
15

Select the correct answer from the drop down menu. Enzymes break down large molecules. In an experiment, a scientist adds lipase

is an enzyme that helps in lapid digestion. The lipid sample breaks down into blank because of the lipase. The scientist heats the enzymes and finds that it can't bind onto the lipids anymore. In digestion this situation will result in blank
Biology
2 answers:
Ivahew [28]3 years ago
8 0

Answer:

Explanation:Hope this help

Natalka [10]3 years ago
4 0

Answer:

There are no options to this question, however, it can be answered. The answers to the blank spaces are:

1. Fatty Acids

2. A decrease in the rate of lipid breakdown

Explanation:

Lipids are large biomolecules that are formed from monomeric units called FATTY ACIDS. Digestive enzymes such as lipase as described in this question breaks down lipids into its monomer called FATTY ACIDS.

However, enzymes are proteinous molecules, meaning they are subject to denaturation when exposed to adverse conditions such as heat. According to this question, the scientist heats the enzymes and finds that it can't bind onto the lipids anymore because it has been DENATURED. This situation will result in the DECREASE IN THE RATE OF LIPID BREAKDOWN because the enzyme in charge is no longer functional.

You might be interested in
what percentage is the tonicity of the medically administered intravenous solutions? what would happen if the tonicity gets lowe
Sunny_sXe [5.5K]

Answer:

<h2>The Infusion Nurses Society (INS) classifies a solution as isotonic if its tonicity falls within (or near) the normal range for blood serum-between 280 and 300 mOsm/liter. A hypotonic solution has an osmolarity less than 280 mOsm/liter, and a hypertonic solution has an osmolarity greater than 300 mOsm/liter.</h2>

<h2>Hopefully u will satisfy with my answer..!!</h2>

<h2>Have a nice day ahead dear..!!</h2>

3 0
2 years ago
Consider the food chain of grass → grasshopper → mouse → snake → hawk. about how much of the chemical energy fixed by photosynth
Komok [63]
0.1%, use the 10% rule. 
5 0
3 years ago
Name at least four process that<br> are common to most living things
Kisachek [45]

organization, metabolism, responsiveness, movements, and reproduction.

8 0
2 years ago
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
Describe how Newton’s Laws explain how a rocket in space can move objects.
Brilliant_brown [7]
The gravity is changing in space so everything moves around
6 0
3 years ago
Other questions:
  • The smallest unit capable of carrying out life functions is:
    6·1 answer
  • How do aerobic bacteria differ from anaerobic bacteria?
    14·1 answer
  • Which of the following is not a characteristic of enzymes?
    10·1 answer
  • Limestone deposits can help researchers learn about what the area was like
    13·1 answer
  • If there is a first- and second-degree burn of the same area, you would report:
    15·1 answer
  • GIVING 20 POINTS!!! PLEASE HELP!!! WILL MAKE BRAINLIEST!!!!
    15·1 answer
  • Kathy has been exercising vigorously for the past half hour. Her body feels sore and she feels pain in her limbs. What could be
    8·2 answers
  • What is relay neuron?
    15·1 answer
  • What is a test variable? Give an example.
    15·2 answers
  • The diagram shows two parent cells with chromosomes
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!