In Galapagos Charles Darwin Discovered a large amount of birds and reptiles that had developed a sense of isolation from the main land.
Explanation:
B cover the cut with a clean dressing and apply pressure.
hope this helps (;
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
The answer is b because diffusion is the transfer of particals from high to low and osmosis involves water
