1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
harina [27]
2 years ago
11

Tony frequently stumbles when he walks. He observes that his father

Biology
1 answer:
liberstina [14]2 years ago
3 0
Tommy can go stumble down i dont even know
You might be interested in
Scientists have recently devised a new six-kingdom classification of organisms. According to the cladogram for the six-kingdom s
lisov135 [29]
The six Kingdoms : Plants, Animals, Protists, Fungi, Archaebacteria, and Eubacteria. 

I hope this Helps!
6 0
3 years ago
Read 2 more answers
Which of the following situations best illustrates a mutualistic relationship?​
Mashcka [7]

Answer:Could You show the answer choices?

Explanation:

5 0
2 years ago
He warning label that appears on products containing nutrasweet (aspartame) is necessary to prevent problems for people with ___
Fed [463]
It is necessary for people with Phenylketonuria


4 0
3 years ago
HELP!!!! Time crunch!
Mila [183]

Answer:

Glycolysis is a series of reactions that take place in the cell cytoplasm. It involves the oxidation of glucose into pyruvate (a 3 carbon compound), that produces (overall)ATP and reduced NAD: an enzyme that carries hydrogen. The number of carbons in each of these compounds is indicated in the green circle.

The carriers FAD and NAD bring the hydrogen and it separates to H+ and electrons (e-). The electrons pass from carrier to carrier and loose energy. This is used to synthesize ATP.

However, there are a lot of hydrogen ions, that unless they are removed, they'll cause a large increase in pH. Therefore, oxygen reacts with the ions to remove it and produce water. This is what the oxygen you inhale is used for (in terms of respiration).

Explanation:

:) hope that helps  

:) Dez-tiny

7 0
2 years ago
Brown rabbits have the genotypes BB or Bb. White rabbits have the gene type bb. If two brown rabbits, with the genotypes seen in
Masteriza [31]

Answer:

the answer would probably be 75%

Explanation:

If you do a punnet square it will show the results.

5 0
2 years ago
Read 2 more answers
Other questions:
  • The presence of two deltas in a fingerprint indicate?
    8·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • [I need help -FAST-!! Please help!!]
    10·1 answer
  • Why is planting cover crops more sustainable than many traditional methods of farming?
    10·1 answer
  • Eating local food is often considered a way to "go green" and help the
    11·2 answers
  • When DNA is duplicated during mitosis, _____.
    13·1 answer
  • Which of the following valve closings can be auscultated during the "dupp" heart sound by placing the stethoscope at the left st
    9·1 answer
  • Idk which go in which
    14·1 answer
  • How do the molecular components in carbohydrates compare to the molecular components in amino acids?
    9·1 answer
  • Gel electrophoresis is used to separate DNA fragments on the basis of
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!