1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bess [88]
3 years ago
8

How do plants produce their food?

Biology
1 answer:
ch4aika [34]3 years ago
4 0

Answer:

photosynthesis

Explanation:

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
In this lab, we assumed that the only acid in our juice sample was citric acid, but other acids may be present as well. Ascorbic
gregori [183]

Answer:

The presence of other acids in our juice causes our calculated concentration of citric acid to be falsely high.

Explanation:

The presence of other acids in our juice causes our calculated concentration of citric acid to be falsely high and we would have to account for the other acids in this case.

5 0
3 years ago
Read 2 more answers
What is the active ingredient of aspirin that would provide clues about its classification by ph (acid, base, neutral)?
Dafna11 [192]
Salicilic acid c7h602 so it s an acid
8 0
3 years ago
Leukopenia is a condition characterized by a decrease in white blood cells. What effect does leukopenia have on the body's abili
Korolek [52]

Leukopenia means  a low count of white blood  cells in the body. When there is a low white blood cell count in the body, and in particular a low level of neutrophils (a kind of white blood cell that fights infection), there is quite a significant risk of developing an infection, and once an infection is developed and the white blood cell count is low, the body will not be able to protect itself and fight off the infection. In severe cases , infection may lead to death.


6 0
3 years ago
Read 2 more answers
How is a mitochondria’s structure related to its function
pashok25 [27]

It is because it's surface area is responsible for the production of ATP molecules.

8 0
3 years ago
Other questions:
  • Mr. Palazzo, a fisherman in his late 60s comes to your clinic complaining of small ulcers on his forearms, face and ears. He has
    8·1 answer
  • Why do bacteria become resistant to antibiotics over time?
    15·2 answers
  • Describe one negative effect of disruption of the Neycle on aquatic systems,
    15·1 answer
  • if a space probe sends back information on an object traveling through space at close speed of light , astronomers will be worki
    6·1 answer
  • Where is the inherited information that determines a cell’s function?. . A.. lysosomes. . B.. mitochondria. . C.. genes. . D.. c
    6·2 answers
  • Which three factors in an environment can lead to natural selection? A. Predation B. Competition C. Limited resources D. Abundan
    10·1 answer
  • Match the following vocabulary words with the correct definitions.
    8·1 answer
  • What is the average for the following set of measurements?
    10·1 answer
  • Yo wassup what is the best cell ever
    6·2 answers
  • Who want to play a CaHoot.772 645 is the code
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!