C is the answer.
Metamorphic rocks is when a rock changes under time and lots of pressure.
Sedimentary is rocks made of sediment.
Igneous rocks are rocks that are made of magma.
Knowing this, C is closest to the definition of metamorphic rocks.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Mitosis is a process cell division, where one cell divides into two identical cells. Mitosis consists of four phases ~ prophase, metaphase, anaphase, telophase and cytokinesis
The answer is palpitation.
They both envole the earth
