3 years ago

What happens to nearly all of the UV radiation that enters the atmosphere?

Biology

2 answers:

Rainbow [258]3 years ago

6 0

Answer:

i know im late but a better answer would be

Some of the sun's energy, though, is reflected from our atmosphere and sent back into space. -Can contain some heat and reflect out some of the heat. What happens to nearly all of the UV radiation that enters the atmosphere The Ozone layer absorbs most of the UV radiation that enters the atmosphere.

goldenfox [79]3 years ago

4 0

It gets reflected or absorbed.

You might be interested in

How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG

Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0

3 years ago

Explain how phospholipids form cell membranes.

dem82 [27]

Answer:

Phospholipids are able to form cell membranes because the phosphate group head is hydrophilic (water-loving) while the fatty acid tails are hydrophobic (water-hating). They automatically arrange themselves in a certain pattern in water because of these properties, and form cell membranes.

Explanation:

6 0

2 years ago

How many different amino acids are there that make up all of the proteins in our body

NNADVOKAT [17]

Answer: billions of types of proteins

5 0

2 years ago

I really need to know this pls help me

TEA [102]

Well are you gonna show us the question

7 0