1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adell [148]
4 years ago
14

What provides instructions to an Eukaryotic cell about living and growing?1.mitochondria2.nucleus3.plasmids4.dna

Biology
2 answers:
Vlad [161]4 years ago
7 0
DNA is the answer to your question

NemiM [27]4 years ago
4 0
The answer would be 4.DNA
You might be interested in
And an experiment which variable changes in response to the manipulation of another variable
maria [59]
Probably (stimuli) hope this helps at all buddy
6 0
3 years ago
PLEASE HELP. 20 POINTS
Ksenya-84 [330]

Caryn has a 50 percent chance of developing Alpha-1.

6 0
3 years ago
A child with brown eyes inherited a brown-eyed gene from one parent and a blue-eyed gene from the other parent. Which of these d
serg [7]

Answer:

hybrid I think yaa I think

3 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
When the light flashes into your eyes the pupils get smaller. which terms describes this action.
stealth61 [152]
This is possibly a reflex action
8 0
3 years ago
Read 2 more answers
Other questions:
  • According to cell theory which of the following are made of cells?
    11·2 answers
  • If a chromosome has 4 chromosomes in each sperm cell, its diploid number is
    7·1 answer
  • Why is it recommended that athletes add water to their sugar based drinks like Gatorade during sports events
    12·1 answer
  • Human skin can heal after it has been cut. What is this an example of?
    8·2 answers
  • Plants and other producers make their food using photosynthesis<br> O<br> O<br> True<br> False
    13·1 answer
  • Behavior can be influenced by genetic traits.<br> True<br> False
    14·1 answer
  • in fruit flies (drosphilia), one eye color Gene is x-linked, with a recessive white allele and a dominant red allele. if white e
    9·2 answers
  • You are breeding alligators to be reintroduced in the wild. One of the female alligators is albino. Would it be possible to get
    8·1 answer
  • NO LINKS AND NO FAKE ANSWERS. Tony has a mass of 50 kg, and his friend Sam has a mass of 45 kg. Assume that both friends push of
    10·1 answer
  • Which of the following is true about acid rain? a. It is more acidic that normal rain. b. It is less acidic than normal rain. c.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!