1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nordsb [41]
3 years ago
13

How has Africa’s history affected the human geography of Africa that exists today?

Geography
1 answer:
Ivan3 years ago
4 0

Answer:

???????????????

Explanation:

You might be interested in
Which of the following is not a convergent boundary?
DaniilM [7]
The correct answer is letter D. Oceanic-Continental. The answer is oceanic-continental because of the transform. The transform itself is a boundary is essentially a horizontal movement of plates relative to each other. ON the other hand a Convergent is where plates converge.
4 0
3 years ago
BRAINLIST FAST AND QUICK
ValentinkaMS [17]

Answer:

that is false

Explanation:

you don't get drowsy in bad whether while Driving

5 0
3 years ago
How does the coriolis effect contribute to formation of tropical cyclones ? ​
algol13
The Coriolis effect is an inertial force that acts on objects that are in motion within a frame of reference that rotates with respect to its inertial frame. Any reference frame with clockwise rotation, the force acts to the left of the motion of that object; and vice versa.

Since the the earth rotates on a 23° axis, circulating air is deflected towards the right in the northern hemisphere and towards the left in the southern hemisphere.

Because the air is moving in a curved path creating circular spin patterns as the air travels from areas of high pressure to low pressure.

And so that’s why hurricanes in the north rotate counterclockwise, and tropical cyclones in the south rotate clockwise.

I hope that helps.
6 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Which major U.S trading partners in 1950 were not major trading partners of the United Stares in 2010
Tom [10]

Answer:

B. Canada and Mexico

Explanation:

https://www.census.gov/foreign-trade/statistics/highlights/top/top1012cm.html

5 0
3 years ago
Other questions:
  • Sometime in the next 20 years, NASA plans to send humans into space to
    9·1 answer
  • What valuable natural resource was discovered in ecuador's selva in the 1960s?
    9·2 answers
  • HELPP MEE PLZZZ the subject is Science<br><br> 1. What is the purpose of the lab?
    11·2 answers
  • Which of the following is a property of honey as a liquid
    5·1 answer
  • Which layer of soil is the most newly formed?
    6·1 answer
  • What is the longitude of the prime meridian?
    8·1 answer
  • Sedimentary rocks are formed chemically and known as ________.
    14·1 answer
  • Imagine that biostimulation is used on a widespread scale for a bioremediation project.
    8·1 answer
  • What fraction of California adults over 25 have earned a 4-year college degree?
    7·2 answers
  • SOMEONE PLEASE HELP ME WITH THIS ONE!!! ASAP
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!