1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
3 years ago
11

The chromosome of a bacterium

Biology
2 answers:
artcher [175]3 years ago
5 0
What the other person said
BabaBlast [244]3 years ago
3 0

Image result for The chromosome of a bacterium

The bacterial chromosome is one long, single molecule of double stranded, helical, supercoiled DNA. In most bacteria, the two ends of the double-stranded DNA covalently bond together to form both a physical and genetic circle. ... coli, a bacterium that is 2-3 µm in length, has a chromosome approximately 1400 µm long.Answer:

Explanation:

You might be interested in
Which part of the neuron communicates an electrical signal to target tissue?
kirza4 [7]
The answer is- (c)Axon

3 0
4 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Based on fossil evidence about how long ago did the first single-cella’s life from appear on earth
Iteru [2.4K]

Answer:slat

Explanation:

Slat rat

6 0
3 years ago
Read 2 more answers
Cells created by meiosis can be
Hitman42 [59]

Answer:

D. N

Explanation:

Meiosis is a kind of cell division which produces daughter cells that are genetically different from the parent cell and have a reduced number of chromosomes (by half).

Meiosis occurs only in reproductive cells to produce gametes. If a diploid (2n) cell undergoes meiosis, a haploid (n) daughter cell will result. This means that the chromosome number has been reduced by half in order to maintain the chromosomal number of the next generation.

6 0
3 years ago
In the cell, energy that drives endergonic reactions is often obtained from
IRISSAK [1]

Answer: B) energy released from exergonic reactions.  

Explanation:

Cell metabolism is the set of reactions that occur in the cellular environment to synthesize or degrade biomolecules to produce energy. Synthesis metabolism of biomolecules is known as anabolic (anabolism) and catabolic degradation (catabolism).

Endergonic reaction (product has more energy than reagents) and requires energy to occur. Anabolism occurs when the cell has sufficient energy or substrate. Catabolism, in turn, occurs in situations in which the body needs energy, such as between meals and fasting.

The reactions of anabolism and catabolism are opposite but occur in an articulated manner, allowing the maximization of available energy. Thus, while catabolism occurs spontaneously, an exergonic reaction with ATP production, anabolism is non-spontaneous, or endergonic, requiring energy to occur. In other words energy that drives endergonic reactions is often obtained from B) energy released from exergonic reactions.

5 0
4 years ago
Other questions:
  • Enzymes are biological _________ that speed up chemical reactions in living organisms
    11·1 answer
  • 10 home remedies for diseases
    11·1 answer
  • Choose the best scientific design to test the question “Which soil type results in the highest yield of tomatoes: clay soil or s
    13·1 answer
  • A threatened species is likely to have _____ than an endangered species.
    9·2 answers
  • Hi! I hope your day is going great. I need some help, please. :)
    7·2 answers
  • Adequate intake of which nutrient has been shown to reduce the risk of neural tube birth defects?
    10·1 answer
  • What happens to animals that are deprived of oxygen
    10·2 answers
  • A mechanical ventilator may aid directly in pulmonary ventilation. external respiration. internal respiration. pulmonary ventila
    10·1 answer
  • In a controlled experiment, which group experiences the test?
    8·2 answers
  • What viral reproduction cycle allows the cell to reproduce it self along with the viral genetic material
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!