1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
s2008m [1.1K]
3 years ago
9

why would your girl not chat with you after like 3 days? me and mine haven't at all on here the last three i feel sad to and dow

n a lot
Biology
2 answers:
mel-nik [20]3 years ago
5 0

Answer:

Usually girls do that when the guy has done something wrong. Or she could be dealing with something. There is no need to feel sad just be paitent! <3

Explanation:

Lostsunrise [7]3 years ago
5 0

Answer:

where´d you go lol

Explanation:

You might be interested in
I just bombed this test and i have 1 retake left. please help!!
MatroZZZ [7]

Answer:

Hey!

Your answer is CO-ENZYME!

Explanation:

What do CO-ENZYMES do?

They are an organic (but not protein based) compound...they act in a reaction by assisting the enzymes to bind and react with another substance...this then makes the reaction even faster!

But they cannot ever work by themselves to catalyse a reaction!

<h2><u>I HOPE THIS HELPED YOU!</u></h2>
8 0
3 years ago
What challenges do scientists face when classifying a new fossil?
nikklg [1K]
It is not easily recognizable
3 0
3 years ago
Read 2 more answers
Match each field of study with its main focus.
umka2103 [35]
Anthropology=human culture, hydrology=water, meteorology=climate, and geophysics=inside of earth.

Hope this helped!
5 0
2 years ago
Please try not to use online and try to answer all the question and help me quickly please
Umnica [9.8K]
Huh what that’s not an question
6 0
3 years ago
What is the common component of air pollution?
Ghella [55]

The common component of air pollution is particulate matter (PM). This is a complex mixture of extremely small particles and liquid droplets.

 The major components of PM are sulphates, nitrates, ammonia, sodium chloride, black carbon, dust particles and water. PM comes from dust , soot, smoke, industry and vehicle exhaust as well as complex chemical reactions with other pollutants.

 Burning of fossil fuels produces sulphur dioxide . It is a colorless gas that pollutes the air and can cause health problems affecting the respiratory system.


7 0
3 years ago
Other questions:
  • Why are desert solis low in organic matter?
    7·2 answers
  • ____ occurs when one or more populations of a species is no longer found in an area it once inhabited, but is found elsewhere.
    9·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which sense would you expect a deep ocean organism to rely on the least
    13·1 answer
  • Which phrase best explains the many varieties of dogs at a dog show? A) cross pollination B) selective breeding C)survival of th
    9·1 answer
  • An adaptation is __________.
    13·1 answer
  • Ý nghĩa chủ yếu của việc phát triển các vùng chuyên canh cây công nghiệp lâu năm ở Tây Nguyên là
    10·1 answer
  • True or false: autosomes are sex chromosomes
    13·2 answers
  • What does each letter represent in the DNA strand AGTTACA?
    10·2 answers
  • Sharks are the top predator in a marine ecosystem. By eating them, sharks maintain a balance in the population of smaller organi
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!