Answer:
There will be 2 molecules.
Explanation:
Each PCR cycle replicates one DNA molecule. This cycle lasts about 2 minutes where the Denaturation (where the DNA double helix is separated) phases occur, Bonding (where prmiets begin to establish complementary hydrogen bonds to the nitrogenous bases of the two DNA strands) and Synthesis (Where DNA polymerase begins to create new strands of DNA). Prior to the first round of PCR there was a DNA sample. However, after one cycle this sample was replicated, so the PCR reaction will follow with 2 DNA samples.
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
The answer is B!!!! it’s pretty easy
The pneumatic bones are important to birds for respiration. They are hollow bones which are connected to the bird's respiratory system and are important for birds to be able to breath. Examples of pneumatic bones are the skull, humerus, clavicle, keel (sternum), pelvic girdle, and the lumbar and sacral vertebrae.
