1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rasek [7]
3 years ago
7

A lizard sitting on a rock would be considered the level of organization.

Biology
1 answer:
Anton [14]3 years ago
3 0

Answer:

Organism

Explanation:

The organism level of organization is the level of organisation that comes after the organ system level of organisation. The organism level of organisation is the level at which the living system is complete and comprises of the interconnection and synergy of the lower organization levels.

At the organism or life form organizational level, all the characteristics of living things are manifested.

The basic living system, a functional grouping of the lower-level components, including at least one cell.

You might be interested in
Describe the base-pairing rules in any DNA molecule
In-s [12.5K]
The selective pairing of adenine (A) with thymine (T) and guanine (G) with cytosine (C) is based on the number of hydrogen bonds established between one of the purine bases and the one pyrimidine bases
6 0
3 years ago
What is the family, genus, and species?
viva [34]

Answer:

can you please provide the name of this leaf...

6 0
3 years ago
What will happen to a tide pool itself if star fish are removed from the ecosystem?
ICE Princess25 [194]

Answer:

the ecosystem will be disturbed... the animals feeding on it will be reduced due to lack of food and the animals on which the star fish was feeding will be increased which causes a total imbalance in ecosystem..

6 0
3 years ago
Based on the diagram which statement describes sexual reproduction?
Doss [256]

Answer:

yessirrrr

Explanation:

6 0
3 years ago
In what year did the goverment introduce a strict cleaning program for the hospitals
Jet001 [13]
It became clear in the 1970's


7 0
4 years ago
Other questions:
  • ANSWER QUICKLY
    10·1 answer
  • glucose is _____during photosynthesis...A: formed B: a rectant C: converted D: reacts with water and carbon dioxide
    10·2 answers
  • Name the four kingdoms of eukarya and give two characteristics of each
    8·1 answer
  • What was Ventor's contribution to science?
    5·2 answers
  • What are all organelles in cells? both animal and plant cells.?
    12·1 answer
  • A serious, inflammatory condition in which the colon mucosa protrudes through the colon wall is called __________.
    15·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Why are hurricanes considered more damaging than tornadoes when tornados have stronger winds?
    15·1 answer
  • PLEASE HELP HURRY PLEASEEEE
    5·2 answers
  • Question: The organelle responsible for photosynthesis is the _________
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!