Genetic diversity serves as a way for populations to adapt to changing environments. With more variation, it is more likely that some individuals in a population will possess variations of alleles that are suited for the environment. Those individuals are more likely to survive to produce offspring bearing that allele.
The answer is; desertification
Topsoil is usually the riches soil in terms of nutrient is important in support of plant vegetation. It is rich because it contains humus and other decomposed materials that recycle nutrients. When the topsoil is washed away, the local region becomes barren in that it cannot support vegetation. This causes the area to turn into a desert.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
