1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitrij [34]
4 years ago
5

Explain how the backbone of DNA is constructed from nucleotide building blocks.

Biology
1 answer:
Ket [755]4 years ago
3 0

Answer:

B

Explanation:

You might be interested in
What molecule was theorized to give rise to many of the important bio molecules that we see 1 point
slava [35]
Answer: C) RNA
......
7 0
3 years ago
A large stored sugar found in plant roots, fruits and seeds
bonufazy [111]
  • Plants convert glucose into starches and they store it into seeds and roots and the simple sugar glucose is converted into fructose to be stored into fruits.
  • As simple sugars are water soluble they can be easily used and in some cases the they are stored in stem such as corn ,etc
5 0
4 years ago
Your employer let’s you know that the safety data sheets are located on an computer in his office. Does this comply with employe
oksian1 [2.3K]

Answer:

The answer to the enunciated: your employer lets you know that the safety data sheets are located on a computer in his office. Does this comply with employer responsibilities? is:- This act doesn't comply with the responsibilities of the employer.

Explanation:

The responsibilities of the employer are to guide the employed about the things in the company, of the sentence you can deduct two sceneries:

- The employed is in training in the company, the reason why the employer is saying to him where are the safety data sheets, but the correct would be to show the sheets and how function them.

- The safety data sheets are reserved for people with a high rank in the company, the reason why the employer must not say it to the employed.

8 0
3 years ago
What is the difference between cross-sectional and longitudinal research?
Oksi-84 [34.3K]
I think the answer is either B or C, hope this helps! Sorry if it doesn't!
7 0
3 years ago
Read 2 more answers
Bear pigmentation is subject to epistasis of the B alleles by the d alleles. B (black) is dominant over b (brown). D is dominant
White raven [17]

Answer:

9/16 black, 3/16 brown, 4/16 white

Explanation:

             BD         Bd          bD         bd

BD     BBDD      BBDd     BbDD     BbDd

Bd      BBDd      BBdd     BbDd      Bbdd

bD      BbDD     BbDd      bbDD     bbDd

bd       BbDd    Bbdd       bbDd     bbdd

A punnet square can be described as a diagram which is made to predict the genotype as well as the phenotypes of the offsprings of a cross.

To study the epistatis nature of the pigmentation in bear, a punnet square was made and the results of the punnet square are shown above.

The results of the punnet square show that the cross between two bears will have the chances of producing 9/16 black bears, 3/16 brown bears and 4/16 white bears.

4 0
3 years ago
Other questions:
  • Why is the side of the Earth facing the moon pulled harder than the side facing away?
    6·1 answer
  • Gravity causes:
    12·1 answer
  • what is another analogy for describing the difference between prokaryotic cells and eukaryotic cell??
    6·2 answers
  • Females inherit two x chromosomes and males inherit one x chromosome. however, there is not a double dose of x gene products in
    9·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Obstetric sonography is a technology that allows doctors and parents to see images of a fetus as it develops in a woman’s womb.
    6·2 answers
  • The At which point in the eukaryotic cell cycle does mitosis occur? Shows the
    13·1 answer
  • Which expression is equivalent to 7.659
    10·1 answer
  • 2. Two organisms would be most closely related if both have the same classification in which of the following groups?
    15·1 answer
  • What is found inside the nucleus and produces ribosomes
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!