1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fiasKO [112]
3 years ago
7

Genes:

Biology
1 answer:
Assoli18 [71]3 years ago
8 0

Answer:

B. They determine the structural and functional characteristics of each individual

Explanation:

Genes are present in all plants and in all prokaryotes, so answer choices A and E are incorrect. Genes are present in all living things.

Genes do determine the structural characteristics of each individual, but they also determine the functional characteristics.

Structure, which is controlled by genes, directly affects function. For example, a gene could code for a specific protein's structure, which will in turn give it a specific function.

So, the correct answer is B.

You might be interested in
Name some helpful bacteria
Blababa [14]
<span>Lactobacillus
Bifidobacterium
 Streptococcus 
</span><span>Bacillus Coagulans</span>
6 0
3 years ago
Read 2 more answers
3. The diagram below shows a portion of a graduated
Bess [88]
D) 26 mL :) is the answer
8 0
3 years ago
Read 2 more answers
Each trait of a plant is determined by
KatRina [158]

Answer:

Each trait of a plant is determined by a pair of genes.

5 0
3 years ago
What organelle is involved
PSYCHO15rus [73]

There is nothing posted, so it is impossible to answer this question . I apologise.

7 0
3 years ago
What is the difference between diffusion and facilitated diffusion
AveGali [126]

Answer:

what is the difference between diffusion and facilitated diffusion

Diffusion :

Diffusion is net movement of anything from a region of higher concentration to a region of lower concentration. Diffusion is driven by a gradient in concentration.

facilitated diffusion:

Facilitated diffusion is a form of facilitated transport involving the passive movement of molecules along their concentration gradient, guided by the presence of another molecule – usually an integral membrane protein forming a pore or channel.

8 0
3 years ago
Other questions:
  • Charlie is a 2 ½-year-old boy with a history of asthma and allergies. he is on several maintenance medications. his parents rush
    5·1 answer
  • Which of these is not a function of connective tissue in the body?
    9·1 answer
  • Produce a table that displays which molecular bonds are found in the primary, secondary, tertiary structure (the same can be fou
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Mendel crossed two plants that were heterozygous for purple flower color. Which genotypes could he have used to represent the cr
    7·2 answers
  • How does the structure of a compound influence its function?
    11·1 answer
  • Which of the following is an indicator of chemical change?
    8·1 answer
  • Which statement describes an example of the control of gene expression?
    10·1 answer
  • Which type of erosion can place a boulder in the middle of a field ​
    11·2 answers
  • WHAT THREE BY
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!