1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
3 years ago
9

T/F Cell theory was developed before the invention of the microscope. A. True B. False

Biology
1 answer:
AVprozaik [17]3 years ago
4 0
B false

The cell theory was developed in 1665 and the microscope in 1590
You might be interested in
In a watershed system, the two main parts are the
torisob [31]
Found a similar question with the following choices:

a. living things and flowing water

b. climate and soil properties

c. physical setting and biological community

d. climate and landscape features

In a watershed system, the two main parts are the A. LIVING THINGS AND FLOWING WATER

8 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
If you were making a product of artificial "Grow-Lites" for plants, what color light should
UNO [17]

Answer:

<u>-blue and red light</u>

Explanation:

Plants produce sugars or carbohydrates during the process of photosynthesis. They absorb light energy from the electromagnetic spectrum with pigments within the thylakoid membrane, like chlorophyll a, chlorophyll b.

Chlorophylls are made of ringed molecules chlorine, a hydrogenated form of porphyrin with a magnesium ion bonded to four atoms of nitrogen. Chlorophyll a shows the most absorption of red light  (642 nm) and blue light (372 nm); while chlorophyll b shows the most absorption at 626 nm and 392 nm.  

Different types of chlorophyll sidechains change the molecules' absorption ranges; A's methyl group is bound at carbon 7,  B's aldehyde (CHO) ring is bound at carbon 7.  Both absorb light from orange-red and violet-blue wavelengths. As such, the best light wavelengths for photosynthesis are within the blue and red wavelengths (425–450 nm) and (600–700 nm).

8 0
3 years ago
Which of the following life processes requires oxygen in order to prceed
TEA [102]
<span>aerobic respiration requires oxygen.</span>
7 0
4 years ago
Rna in cells differs from dna in that ___________________. select one:
irinina [24]
Hello! 

RNA in cells differs from DNA in that it is single-stranded and can fold up into a variety of structures.

RNA is the abbreviation for RiboNucleic Acid. It is a biological molecule that fulfills an important role by copying the information stored in the DNA (DeoxyriboNucleic Acid) and transporting it to the different proteins by folding into different shapes. Its name come from a Ribose molecule that is present in this single-stranded molecule.  

Viruses don't have DNA, only RNA. They only replicate in the host's cells by copying their own RNA information. 

Have a nice day!
3 0
3 years ago
Other questions:
  • The breaking of a rock along a plane of weakness is called _____.
    5·2 answers
  • PLEASE HELP EARTH SCIENCE! BRAINLIEST TO FIRST CORRECT ANSWER
    5·2 answers
  • 1. What's a stalactite?
    9·1 answer
  • Please help me with this.. very URGENT!! please!!
    11·1 answer
  • A nuclear envelope does not usually form around each set of chromosomes in the haploid daughter cells in _________. A. interphas
    9·1 answer
  • Explain, in complete sentences,​ how hybrid cars help each of the following problems.
    8·1 answer
  • How to make coins dirty
    5·2 answers
  • In self-pollination a plant has both reproductive structures and fertilizes itself with pollen. The offspring is identical to th
    13·1 answer
  • The physical geography of Oceania has most likely caused societies in the region to
    6·1 answer
  • A farmer stopped maintaining a field that was once used to grow crops. Over time, the field eventually became a forest. These ch
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!