1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NikAS [45]
3 years ago
9

A chemist has a solution of 65% pure acid and another solution of 30% pure acid. How many gallons of each will make 350 gallons

of 55% pure acid solution?
Mathematics
2 answers:
Strike441 [17]3 years ago
6 0

Answer:

250 of 65% acid

100 gallons of 30% acid

Really sorry if this is incorrect, I had this question on my Lesson 16 test, and I don't know if it's correct or not...

pantera1 [17]3 years ago
3 0

Answer:

250 of 65% acid

100 g of 30% acid

Step-by-step explanation:

You might be interested in
Could ΔABC be congruent to ΔADC by SSS? Explain.
Vera_Pavlovna [14]
There are 5 ways to test if two figures are congruent, namely;
side-angle-side(SAS)
Angle-side-angle (ASA)
Angle-angle-side(AAS)
Hypotenuse-leg (HL)
3 Sides (SSS)
here we shall focus on SSS. When the three corresponding sides of 2 figures say a triangle have the same length we will conclude that the triangles are congruent by SSS.
Therefore from our choices we can conclude that   triangles ABC and ADC are only congruent if the two other side have the same length and BC=DC.

The answer is yes;
B] Yes, but only if BC=DC
6 0
3 years ago
Read 2 more answers
Find an equation of the line through the given point and perpendicular to the given line
s344n2d4d5 [400]

Answer:

Step-by-step explanation:

The equation of a straight line can be represented in the slope-intercept form, y = mx + c

Where c = intercept

For two lines to be perpendicular, the slope of one line is the negative reciprocal of the other line. The equation of the given line is

y = 2x - 2

Comparing with the slope intercept form,

Slope, m = 2

This means that the slope of the line that is perpendicular to it is -1/2

The given points are (-3, 5)

To determine c,

We will substitute m = -1/2, y = 5 and x = - 3 into the equation, y = mx + c

It becomes

5 = -1/2 × - 3 + c

5 = - 3/2 + c

c = 5 + 3/2

c = 13/2

The equation becomes

y = -x/2 + 13/2

4 0
3 years ago
Which is not personally liable for any losses or damages?
cupoosta [38]

Answer:


Step-by-step explanation:

Ur answer should be C

5 0
3 years ago
Read 2 more answers
2. What if Janelle began by running, then slowed to a walk, stopped, and then began running
stealth61 [152]
I think it is A
Hope this help you
7 0
3 years ago
How do you multiply
vodomira [7]

You multiply using the multiplication table. Multiplication is one of the four basic operations in arithmetic, along with addition, subtraction, and division. Multiplication can actually be considered repeated addition, and you can solve simple multiplication problems by adding repeatedly. For larger numbers, you'll want to do long multiplication, which breaks the process down into repeated simple multiplication and addition problems. You can also try a shortcut version of long multiplication by splitting the smaller number in the problem into tens and ones, but this works best when the smaller number is between 10 and 19.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Find the value of x. A.<br> 18<br> B.<br> 22<br> C.<br> 24<br> D.<br> 28
    10·2 answers
  • A part of your bike has broken. You decide to send it back for a full refund. It has cracked along every line of symmetry.
    11·1 answer
  • What expression is not equivalent to 0
    11·2 answers
  • If sin theta = 4/5 and cos theta is in quadrant II, then cos theta and tan theta equal what?​
    14·2 answers
  • Hi I need help on this ???
    5·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What is the Ratio of 472 and 482?
    5·2 answers
  • Solve the system of linear equations by elimination. 6x-4y=18 3x+2y=-3
    14·1 answer
  • PLEASEEEE HELP AND DONT GUESS
    8·2 answers
  • Identify the population and the sample in the situation below:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!