1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kaheart [24]
3 years ago
13

This animal DOES NOT have live birth, instead this animal...?

Biology
1 answer:
Naily [24]3 years ago
3 0

Answer:

The platypus is one of only five species of monotremes in the world. These are mammals that lay eggs instead of giving birth to live young.

:-))

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Anyone willing to help? I honestly have no clue what I’m doing..
koban [17]
The youngest would be the ones at the top and the oldest would be at the bottom. the oldest is B and the ones around it, as they get bigger get younger. hope this helps :)
8 0
3 years ago
Samantha está probando la velocidad del sonido en una montaña muy fría. Mide la temperatura en -20 ° C. Calcula la velocidad del
Alja [10]

Answer:

318,6 ms-1

Explanation:

Como sabemos que la relación entre la velocidad del sonido en el aire y la temperatura viene dada por;

V = 331√T / 273

Dónde;

V = velocidad del sonido

T = temperatura en kelvin = (-20) + 273 = 253 K

V = 331√253 / 273

V = 318,6 ms-1

3 0
3 years ago
When moving in a cell chloroplast move_____
Vitek1552 [10]

Answer:

Abstract.

Explanation:

Chloroplasts migrate in response to different light intensities. Under weak light, chloroplasts gather at an illuminated area to maximize light absorption and photosynthesis rates (the accumulation response). In contrast, chloroplasts escape from strong light to avoid photodamage.

4 0
3 years ago
How many independent variables should exist in a well designed experiment
Ber [7]


I meant two or more it depends


4 0
3 years ago
Read 2 more answers
Other questions:
  • The Effect on Rogotti on hair growth
    8·1 answer
  • Which organelle is most likely to be found in both Archaea and Bacteria and why?Both require chloroplasts for photosynthesis.
    12·1 answer
  • What is the law of Dominance?
    6·1 answer
  • WILL GIVE BRAINLIEST!! 15 POINTS!!
    8·1 answer
  • What is a molecular clock​
    14·2 answers
  • Why is corn so important to society?
    7·1 answer
  • The _____ demonstrates the cell theory because it develops cells that fuse to form one giant cell, making up the whole organism.
    7·2 answers
  • An enzyme called ________ relieves the supercoiling of the dna caused by unwinding of double stranded dna by ________.
    14·2 answers
  • A student did an experiment with two identical fish tanks, Tank 1 and Tank 2. About 20 ml water purifier was added to Tank 1 and
    14·1 answer
  • Does diffusion require energy??!! (:
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!