Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Cohesive. This means that the water is attracted to other particles of itself, so they stick and bead up.
<span>John can use Cladistic
Analysis as an approach to trace the classifications of the lion and cat
because he can trace a common ancestor for them due to the cat and the lion
having the same characteristics and traits. They are considered to be closely
related because they share a common ancestor which means that they are closely
connected. The earliest discovery of using this method was by Peter Chalmers
Mitchell in 1901 as he was studying how different types of birds belong to the
same ancestry.</span>
Answer:
Topoisomerase
Explanation:
Topoisomerases are enzymes that produce changes in the topology of the DNA during replication, transcription, traduction, or reparation processes. They can cut one or both strands and in order to relieve torsional stresses in the supercoiled structure of DNA. With this, they help to maintain the chromosome's integrity. There are two types of topoisomerases: topoisomerase I (it cuts only one strand of DNA) and topoisomerase II (it is able to cut both strands of DNA).
E. beef liver
none of these foods have cholesterol, in fact avocado can help lower cholesterol.
