1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
krek1111 [17]
3 years ago
9

Amy was observing the growth of five kinds of flowering plants on a windowsill. She noticed that some of the flowers

Biology
1 answer:
8090 [49]3 years ago
5 0

Answer: Flowers need sunlight

Explanation:

Flowers are attracted to the light because its wants makes them grow its kinda like humans  eating food well as a flower they need water air and sunlight as there food.

You might be interested in
What are the small components (monomers) that make up the large DNA polymer?<br> (15 points)
Natasha2012 [34]
They are called <span>nucleotides. </span>
4 0
3 years ago
Julio is studying the bald eagle, which has a binomial name of Haliaeetus leucocephalus. Using the modern system of
Lubov Fominskaja [6]

The kingdom is Animals. The genus is Haliaeetus. The species is leucocephalus are the statements which Julio can make about the bald eagle.

The option C is the correct answer.

Explanation:

Given that Bald eagle has binomial name as Haliaeetus leucocephalus.

Modern classification of binomial nomenclature is given by Carl Linnaeus.

From the modern system of classification the sequence is as kingdom, phylum, class, order, family, genus and species. The classification of bald eagle is:

Kingdom - Animalia

Phylum - chordata

class - Aves

Order- Accipitriformes

family - Accipitridae

Genus - Haliaeetus

species - leucocephalus.

The two word name of the species having genus first followed by species is binomial nomenclature which Julio has used for bald eagle as Haliaeetus leucocephalus.

4 0
3 years ago
What happens to monomers when they undergo dehydration synthesis?
Colt1911 [192]

Answer:

they form long chain-like molecules.

Explanation:

they combine using covalent bonds, and give off water molecules.

3 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
I NEED HELP PLS HELP 14 POINTS
sergij07 [2.7K]

Answer:

Earth rotation...is the reason

5 0
2 years ago
Other questions:
  • What trace mineral is essential to sperm production and taste perception, and assists in immune function?
    5·1 answer
  • What is a biome and how are biomes grouped​
    7·1 answer
  • This aquatic area is one of the most productive on Earth. More organic matter is created ere each year than comparably-sized are
    15·1 answer
  • Which characteristic of life is demonstrated when eagles use their sharp talons to get fish out of the water.
    5·2 answers
  • Why do we dream............this is a science question?
    12·2 answers
  • In which phase of the cell cycle do cells grow and synthesize new protiens and organelles
    5·1 answer
  • A house cost $120,000 when it was purchased. The value of the house increases by 10% each year. Find the rate of growth each mon
    6·1 answer
  • A group of biologists would like to recreate suitable habitats for wildlife in a particular area. They would also like to help f
    13·2 answers
  • (GIVING BRAINLIEST!!)
    5·1 answer
  • Which statement describes a deciduous tree?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!