How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT

Question

UNO [17]

3 years ago

15

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT

CATCATCATCATTTAAGCTTCAAAGCTT

Law

1 answer:

andreyandreev [35.5K] · Answer 1 · 2022-07-20T14:59:43+03:00

andreyandreev [35.5K]3 years ago

7 0

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.