1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UNO [17]
2 years ago
15

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT

CATCATCATCATTTAAGCTTCAAAGCTT
Law
1 answer:
andreyandreev [35.5K]2 years ago
7 0

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

You might be interested in
Do you think it is right for judges and lawyers to use plea bargains and summary judgments to bypass juries? Why or why not?
fiasKO [112]

Answer:

Yes i think this is right. Many successful criminal prosecutions in the United States end not with jury trials. Instead this gives a defendant a chance for a shorter sentence, especially if the defendant is not guilty. Agreeing to plead guilty to some or all of the charges against them in exchange for concessions from the prosecutors. These agreements allow prosecutors to focus their time and resources on other cases, and reduce the number of trials that judges need to oversee.

Explanation:

<em>None Needed</em>

8 0
2 years ago
Read 2 more answers
What type of law regulates government bureaucracies?
SIZIF [17.4K]
The answer is choice d
6 0
2 years ago
Read 2 more answers
Yo what is (6x9)+(6+9) pls answer it will make your day NICER.
Serga [27]

Answer:

the answer is 89

Explanation:

6×9=74

6+9=15

6 0
3 years ago
Read 2 more answers
Please hurry!!!!
-Dominant- [34]

Answer:

b i think

Explanation:

7 0
3 years ago
Read 2 more answers
What are the tiny lines found on fingers, Palms, toes, and soles called
Afina-wow [57]
Palmar flexion creases
8 0
2 years ago
Other questions:
  • What level of government gets most of its revenue from income tax?
    5·1 answer
  • Do you agree or disagree with the supreme court’s majority ruling in yarborough v.Alvarado? Write a short paragraph describing y
    8·2 answers
  • What should you do while driving into a headwind
    7·2 answers
  • 3
    15·2 answers
  • What is needed in a report? *
    10·2 answers
  • Why do you think women’s human right is important?
    11·1 answer
  • How many police zones does Port Orange FL have?
    15·1 answer
  • The case: Sixteen-year-old Terry was in a bedroom at his family's home with his younger brother when he pulled a handgun from un
    14·1 answer
  • 21. Education promotes all of the following EXCEPT
    10·1 answer
  • Consider how Jim Crow Laws influenced life for African Americans. In what ways do you think racial/ethnic minority groups in the
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!