1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UNO [17]
3 years ago
15

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT

CATCATCATCATTTAAGCTTCAAAGCTT
Law
1 answer:
andreyandreev [35.5K]3 years ago
7 0

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

You might be interested in
Anyone who marks me brainlist gets 100 POINTS!!!!!
kondaur [170]

Answer:

THANK U FOR THE PTS

Explanation:

HAVE A WONDERFUL DAY

4 0
3 years ago
Read 2 more answers
Which one is not a type of danger with law enforcement?
asambeis [7]
I think the answer would be E none of the above because all of them are types of dangers law enforcement may have to encounter
5 0
3 years ago
Needs of victims after they been labor trafficked
Firlakuza [10]

Answer:

time and therapy

Explanation:

common sense

4 0
3 years ago
I'm in there just no gonna show location ​I'm sorry for those of u in tornado watches
nikklg [1K]
Well that sucks, good luck to you guys in Arkansas.
6 0
2 years ago
Which of the following is considered as innovative criminal defense strategy?
Likurg_2 [28]

Considering the available options, the choice that is considered as an innovative criminal defense strategy is "<u>battered women's syndrome."</u>

<h3>What is battered women's syndrome?</h3>

Battered women's syndrome is a medical and psychological term that is used to describe the severe mental health ailment resulting from serious domestic abuse.

Given the legal situation, battered women's syndrome is not a typical condition that is common but has been innovated by some defenders to justify their offense so they can get discharged and acquitted.

Hence, in this case, it is concluded that the correct answer is <u>Battered women's syndrome.</u>

Learn more about the criminal defense strategy here: brainly.com/question/11342133

5 0
3 years ago
Other questions:
  • Critical theory argues that the most powerful groups use the law to serve their needs and to oppress less powerful groups. Is th
    8·1 answer
  • When I go into questions that I answered I'm the only one reported?
    11·1 answer
  • 1. Which of the following is an S corporation permitted to do?
    10·1 answer
  • How are the Florida
    6·2 answers
  • What do you do when your grouned?
    10·1 answer
  • What are 8 criminal law vocabulary words
    9·1 answer
  • What is the document that police use to show a judge they have probable cause?
    9·1 answer
  • Which of the following is an example of a nonprimary homicide?
    11·1 answer
  • Examples of agreements that violate government statutes and are unenforceable by the courts are contracts for the sale of alcoho
    11·2 answers
  • cowper summarizes _____ by saying that we will have 100 years of progress in the next 25 years and 20,000 years of progress in t
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!