1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UNO [17]
3 years ago
15

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT

CATCATCATCATTTAAGCTTCAAAGCTT
Law
1 answer:
andreyandreev [35.5K]3 years ago
7 0

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

You might be interested in
Jack purchases a cola drink at a fast food chain, while drinking he determines the cola is a caustic drain cleaner. Jack may sue
Natali [406]

Answer:

breach of the implied of merchantability

Explanation:

Implied warrant of merchantability happens when an individual such as jack in this question, goes to buy a product that did not work as expected. In this case, Jack requested for a Cola drink which he bought and later realized it was caustic drain cleaner. The warranty guarantees that the cola drink gotten from the fast food chain must work according to why it was purchased and the sellers are not required to explain to jack that Cola drink is what he was going to get when buying the product from them because the law on its own, creates that warranty.

5 0
3 years ago
Which role does the legislative branch play in making public policy?
MatroZZZ [7]

Answer:

D. Passing a new law about endangered species.

Explanation:

A legislature refers to the legislative body or arm of the federal government that are typically saddled with the responsibility of making or enacting laws. The state legislature is one of the body of governance that has the power or authority to ratify (approve, confirm or give consent) a proposed amendment to the Constitution by getting three-quarter of the states to vote in support.

A bicameral legislature can be defined as a legislative body that comprises of two chambers or houses; the upper house and lower house. The upper chamber or house consists of senators while the lower chamber consists of house of representatives.

Generally, the type of government in which legislators such as senators or house of representative members are found is known as a democracy and they are saddled with the responsibility of enacting or making (passing) new laws.

This ultimately implies that, the role the legislative branch play in making public policy is passing a new law about endangered species. The new law could place a ban on poaching and wildlife hunting while promoting ideas that enhances the conservation of all endangered species, which are going into extinction.

Additionally, a policy can be defined as a conduct or principle of behavior expressed by the government (authority) and are mainly considered to be beneficial and necessary for the growth and development of a person, institution and the society.

8 0
3 years ago
I have a putty .so it got fitted off
sattari [20]

Answer:

asfatdsfgsdfrawfgdsgsdfgsdfgsrgfdsdfgsfdgsr

Explanation:

3 0
3 years ago
The three main sources of international law are treaty, custom, and
jek_recluse [69]

Answer:

General principles of international law

4 0
3 years ago
What level of government is in charge of regulating teacher licenses?​
zheka24 [161]

Answer:

State governments

Explanation:

8 0
3 years ago
Other questions:
  • What is the following text an example of?
    9·2 answers
  • The __________ is the federal statute requiring most records in agency files to be accessible to the public. a. APA b. Governmen
    12·1 answer
  • Be careful with some of the zoom links posted on here, some of them are definately not child appropriate. if you are that despar
    14·1 answer
  • The president's official statement of objection to a bill is called
    15·2 answers
  • Name three reasons for the growth of constitutional governments during the
    14·1 answer
  • whats PINS in ny? My school sent me a letter said I need PINS and there going to contact the court because of me.
    12·1 answer
  • What is one difference between government agencies and government
    5·2 answers
  • Which of the following is considered as innovative criminal defense strategy?
    6·1 answer
  • What is an example of a tier 2 police encounter?
    13·1 answer
  • Let's Check In The five general principles from the APA are meant to __________. A. be enforceable rules B. be posted in every o
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!