1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UNO [17]
2 years ago
15

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT

CATCATCATCATTTAAGCTTCAAAGCTT
Law
1 answer:
andreyandreev [35.5K]2 years ago
7 0

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

You might be interested in
John Maynard Keynes believed that to end the Great Depression, government should _____.
s344n2d4d5 [400]

Answer:

increase spending and lower taxes.

Explanation:

He believed this would stimulate the economy.

8 0
3 years ago
What is the role of local and state governments in the law making process?​
Maurinko [17]

E vidence-based policymaking is relevant for all levels of government. State agencies play an important role in creating and using evidence as they implement policies and collect data while operating programs. The federal government can also help support and enable activities at the state-level.

6 0
2 years ago
Read 2 more answers
Internal role players who are responsible for rehabilitation of offenders in corrections
Illusion [34]

Ei primeiro você tem que explicar

4 0
3 years ago
13. On a two-week vacation in a neighboring state,
irga5000 [103]
It’s A because of the law
7 0
3 years ago
SOMEONE PLEASE HELP!
Aleksandr [31]
That is true, think about actions and consequences; everyone has the free will to choose to do what is right.
7 0
2 years ago
Read 2 more answers
Other questions:
  • hey my men is wondering if i can sell bleach and washing upliquid onthe blackmarketand where i can find the answer to 1231312m34
    5·2 answers
  • What are some jobs for 12 years old can do?!?!?!
    11·1 answer
  • Describe an alternative program(s) a person with a disability can apply for if they don’t qualify for SSDI.
    5·1 answer
  • What did Supreme Court decisions incorporating the Bill of Rights mean?
    12·2 answers
  • Which of the following levels of local government can collect taxes?
    14·1 answer
  • Did magna carta promote fairness to the people of england? explain
    10·1 answer
  • The Model Penal Code (MPC) provides that
    10·1 answer
  • Write a hypothesis for Part I of the lab, which is about the effect on an object being carried by a car, when the car experience
    15·1 answer
  • The type of law which deals with an individual's offenses against the state or federal government is called ____ law.
    13·1 answer
  • Any prich conviction for a felony or a misdemeanor crime of dishonesty can be used
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!