1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UNO [17]
3 years ago
15

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT

CATCATCATCATTTAAGCTTCAAAGCTT
Law
1 answer:
andreyandreev [35.5K]3 years ago
7 0

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

You might be interested in
Are we doing enough to tackle racism? <br> Let me know your opinions.
Aliun [14]

We have not done enough. In fact, we are making this situation worse. Racism is not something to tolerate with through violence, I think if we actually solved the problem with peace and change the minds of others, we will do better. I know someone who was anti-racist, but he got targetted from an anti-racist group and it changed him into a racist. (His name is Paul Miller, he is really inspirational if I am honest)

8 0
3 years ago
Read 2 more answers
In a general journal entry, what do write first?
OLEGan [10]

Answer:

Most general journal entries begin with the date. Sometimes the time will also be included, like when recording data/ or time-affected information.

8 0
4 years ago
15 POINTS &amp; BRAINLIEST!!!
melomori [17]

Answer:

https://fs.blog/2018/05/deductive-inductive-reasoning/

Go in the link

6 0
3 years ago
Organized interest groups apply pressure to the government in several ways EXCEPT for which ONE of the following?
OverLord2011 [107]

Answer:

Lobbying. When a representative of an interest group tries to influence the government by communicating with those in government.Litigation. Lawsuits.Mobilizing public opinion. Institutional advertising, protests and demonstrations, and grassroot mobilizations.Using electoral politics

Explanation:

5 0
2 years ago
Describe how the 911 operator and the responding officer work together during an incident.
Kobotan [32]

Answer:

program is the role played by the dispatcher during an emergency incident. ... Fortunately, the second house fire was discovered by a police officer while responding to the first house fire. ... During an in-progress incident, I was able to put 2 & 2 together and ...

Explanation:

you have to study

6 0
3 years ago
Read 2 more answers
Other questions:
  • How do laws of society relate to our individual morals.
    12·1 answer
  • Harry Potter accelerated reader test
    9·2 answers
  • Please tell me what it is
    7·1 answer
  • Yo what is my real name? I if u answer I'll give u BRAINLIEST and all my points
    12·2 answers
  • How many answers can you put or is this open ended?
    11·2 answers
  • Why is federalism important when limiting the power of government?
    10·1 answer
  • If you are being passed, you must _________ until the pass is complete.
    9·2 answers
  • 14
    9·1 answer
  • In what ways has the artist ai weiwei confronted the chinese government’s conduct?.
    10·1 answer
  • What is the most powerful role in the House of Representatives?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!