1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UNO [17]
3 years ago
15

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT

CATCATCATCATTTAAGCTTCAAAGCTT
Law
1 answer:
andreyandreev [35.5K]3 years ago
7 0

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

You might be interested in
Approximately ________ women are victims of domestic violence each year.
EastWind [94]

On average, 24 people per minute.

6 0
3 years ago
Read 2 more answers
In 2014, the number of homicides was what percent of the total number of crimes reported?
Alla [95]

Answer:

c

Explanation:

4 0
3 years ago
Read 2 more answers
How is primary elections differ from national elections?
AnnyKZ [126]

Answer:

primary elections is an election which is primarily

6 0
3 years ago
Read 2 more answers
How has the government tried to make paying for campaigns more fair?​
Yuri [45]

Answer:

Explanation:

If you're referring to regulations:

There is a maximum amount of money individuals and organizations can send directly to candidates (HARD MONEY)

A way to bypass this is if you send money to a political party which then runs ads for campaigns

Example; You already contributed your maximum $5,000 to the Trump Campaign but you want to contribute $20,000 in total so you give the Republican Party $15,000.

Also no foreign money is allowed in political elections.

5 0
3 years ago
In your opinion, what is the most important law and why?
CaHeK987 [17]
Courts because they help settle things
8 0
3 years ago
Other questions:
  • Differentiate between patronage and the merit system.​
    9·1 answer
  • It would be inappropriate to refer to "criminal law," as if it were a singular entity. Why is this? Discuss all that "criminal l
    14·1 answer
  • The was instituted by King William in 1066. a. Frankpledge System b. Justice of the Peace c. London Metropolitan Police Act d. N
    12·1 answer
  • The Equal Employment Opportunity Commission (EEOC) possesses the authority to ________. investigate and reconcile whether a clai
    8·1 answer
  • QUESTION 9
    13·1 answer
  • The Civil Rights Act of 1964 prohibits:
    11·1 answer
  • The power of the Supreme Court to hear a case that has already been tried and ruled on in lower courts is:
    6·1 answer
  • How does positivism relate to domestic violence
    8·1 answer
  • Why is it important to demonstrate a positive work attitude in the workplace?
    12·1 answer
  • A safe following distance for a car is?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!