The lab experiment might be dangerous or too difficult to do whereas simulation is a safe and easy way of presenting a process.
<h3>What is a simulation?</h3>
A simulation is a way of imitating a process in the real life in order to predict what will happen and the reason for its happening. Scientists use simulations to answer different questions. It is also used to make predictions.
In conclusion, ''the lab experiment might be dangerous or too difficult to do'' is the correct statement.
Learn more about simulation here: brainly.com/question/1231005
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
Answer:
We use too much carbon dioxide
Explanation:
Because too many plants and animals are dying
Hi! the answer to your question is that A mosaic is a pattern or image made of small regular or irregular pieces of colored stone, glass or ceramic, held in place by plaster/mortar, and covering a surface. Mosaics are often used as floor and wall decoration, and were particularly popular in the Ancient Roman world.Let me know if I am wrong...
Answer:
I and IV
Explanation:
The skeletal system works as a support structure for our body. It gives the body its shape, allows movement, makes blood cells, provides protection for organs and tissues and stores calcium and minerals.
