1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marin [14]
3 years ago
13

Create a Punnett square to solve the following sex-linked inheritance problem (remember to use the sand

Biology
1 answer:
vichka [17]3 years ago
7 0

Answer AND Explanation:

Let H represent gene for normal blood clotting and h for haemophilia.

              XH               Y

Xh          XHXh           XhY

Xh          XhXH           XhY

Male children with hemophilia:  50%

Male children without hemophilia: 0 %

Female children with hemophilia:  0%

Female children that are carriers for hemophilia: 50%

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
A bird flies by moving its wings up and down. Which two systems are most directly responsible for the movement of a bird's wings
aleksklad [387]
A. Skeletal and muscular
the other three don’t have to do with this type of internal movement though as the abdominal region and internal organs don’t have to do with this, A is the only possible answer
4 0
3 years ago
Read 2 more answers
What is one of the causes of mechanical weathering?
neonofarm [45]
Carbon dioxide hopefully I think ❤️
3 0
3 years ago
An infant of a diabetic mother is admitted to the neonatal intensive care unit. what is the priority nursing intervention for th
Anit [1.1K]
If an infant of a diabetic mother is admitted to the neonatal intensive care unit, the nurse should EVALUATE THE EFFECT OF MOTHER GLUCOSE LEVEL IN THE INFANT BY PERFORMING A BLOOD TEST ON THE NEWBORN. This test is known as Heel Stick Blood Test. It is used to determine the blood glucose level in the infant.
4 0
3 years ago
What is the answer i’m unsure of C
Step2247 [10]

Answer:

I don't know but it might be B

3 0
3 years ago
Other questions:
  • What type of membrane provides lubrication to the pleural, pericardial, and peritoneal cavities?
    14·1 answer
  • Upon reviewing the client's medical record, the nurse finds the client has left ptosis. the nurse would assess the client for wh
    15·1 answer
  • Which three components are common to all amino acids?
    8·1 answer
  • Which statement about platelets is FALSE?
    12·1 answer
  • A student is taking an animal science and an astronomy class. In animal sciences, she learns that pumas are called mountain lion
    5·2 answers
  • Can someone help me pls
    12·2 answers
  • Which of the following is an example of a ground in a building?
    7·1 answer
  • During one part of the water cycle, heat from the Sun causes liquid water to change into water vapor, which rises into the atmos
    12·2 answers
  • Cells have different membrane carbohydrates if they do different
    12·1 answer
  • True or false: Due to starvation, amino acids from muscle tissue are converted into glucose. This wastes muscle tissue and can l
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!