A split-brain patient sees something in her left visual field and must go after a screen and choose the object from a group of objects. she will choose the object perfectly with her left hand.
<h3>What can a split-brain patient do if they see something in the left visual field?</h3>
The fact that split-brain patients can only accurately respond to stimuli in the left visual field with their left hand and to stimuli in the right visual field with their right hand and vocally is another important component of the conventional view.
Patients with split brains can still walk, swim, and ride a bike, which are motor abilities that need both sides of the body and were taught before the onset of their disorder. They can also pick up new skills that require them to move their fingers or hands in parallel or mirror images.
A split-brain patient must reach behind a screen and choose the object from a collection after spotting it in her left visual field. She will use her left hand to make the proper selection of the item.
To learn more about split-brain patient refer to:
brainly.com/question/24879413
#SPJ4
Sorry I don’t understanddddd:/
Answer: CONDITIONS FOR HARDY
No mutations should appear in the beetle population because new alleles would change the allele frequencies
There should be random mating among beetles
There should be no natural selection on the beetle population
The population of beetles must be large enough so that genetic drift is avoided
There should be no migration of beetles into or out of the population.
CONDITIONS FOR EVOLUTION-
Natural selection favors green beetles
Purple mutants appear among the Beatles
Preferred mates are red, so these individuals reproduce
Large numbers of brown beetles were killed in a forest fire
A significant number of yellow beetles left.
Explanation: I only added about half the sentence of each answer because it’s to long.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
I think the answer will be C